United States Patent6391605
Kostrewa , ; et al.May 21, 2002

Title

Modified phytases

Abstract

A process for the production of a modified phytase with a desired property improved over the property of the corresponding unmodified phytase is disclosed, as well as modified phytases, polynucleotides encoding modified phytases, and animal feed including modified phytases.


Inventors:Kostrewa; Dirk (Freiburg, DE), Pasamontes; Luis  (Trimbach, CH), Tomschy; Andrea  (Grenzach-Wyhlen, DE), van Loon; Adolphus  (Rheinfelden, CH), Vogel; Kurt  (Basel, CH), Wyss; Markus  (Liestal, CH)
Assignee:Roche Vitamins Inc. (Parsippany, NJ)
Appl. No.:044718
Filed:March 19, 1998
Foreign Application Priority Data

Mar 25, 1997 [EP] 97810175

Current U.S. Class:435/196 424/94.6 
Field of Search:435/196 424/94.6

U.S. Patent Documents
5436156July 1995Van Gorcom et al.
5443979August 1995Vanderbeke et al.
5863533January 1999Van Gorcom et al.
Foreign Patent Documents
0 035 204Sep., 1981EP
0 422 697Apr., 1991EP
0 758 018Feb., 1997EP
0 897 010Feb., 1999EP
0 897 985Feb., 1999EP
1 492 060Mar., 1969DE
299 108Jan., 1989EP
420 358Apr., 1991EP
619 369Oct., 1994EP
684 313Nov., 1995EP
747 483May., 1997EP
93/16175Aug., 1993WO
94/03612Feb., 1994WO
98104858Feb., 1999EP
WO 91/14773Oct., 1991WO
WO 95/00662Jan., 1995WO
WO 98/54980Dec., 1998WO
Other References
Dox et al., J. Biol. Chem. 10:183-186 (1911). .
Davis et al., Enzyme Microb. Technol. 5:377-382 (1983). .
Lambrechts et al., Biotech, Lett. 14:61-66 (1992). .
Shieh et al., Appl. Microbiol. 16:1348-1351 (1968). .
Van Hartingsveldt et al., Gene 127:87-94 (1993). .
Piddington et al., Gene 133:55-62 (1993). .
Kraulis, J. Appl. Cryst. 24:946-950 (1991). .
Merritt et al., Acta Cryst., 869-873 (1994). .
Wodzinski et al., Advances in Applied Microbiology 42:263 (1996). .
Mitchell et al., Microbiology 143:245-252 (1997). .
Kostrewa et al., Nature Structural Biology 4:185-190 (1997). .
Simons et al., Br. J. Nutr. 64:525-540 (1990). .
Schoner et al., J. Anim. Physiol. a. Anim. Nutr. 66:248-255 (1991). .
Jongbloed et al., J. Anim. Sci., 70:1159-1168 (1992). .
Perney et al., Poultry Sci. 72:2106-2114 (1993). .
Farrell et al., J. Anim. Physiol. a. Anim. Nutr. 69:278-283 (1993). .
Broz et al., Br. Poultry Sci. 35:273-280 (1994). .
Dungelhoef et al., Animal Feed Sci. Technol. 49:1-10 (1994). .
Piccotti et al., J. Immunol. pp. 643-648 (1997). .
Presentation by Dr. Luis Pasamontes at the Institute of Med. Microbiologie, Basel, Switzerland, Feb. 11, 1997. .
Janecek, S., Process Biochem., vol. 28, pp. 435-445 (1993). .
Fersht, et al., Curr. Opin. Struct. Biol., vol. 3, pp. 75-83 (1993). .
Alber, T., Annu. Rev. Biochem., vol. 58, pp. 765-798 (1989). .
Matthews, B. W., Curr. Opin. Struct. Biol., vol. 1, pp. 17-21 (1991). .
Matthews, B. W., Biochemistry, vol. 26, No. 22, pp. 6885-6888 (1987). .
Stuber et al., in Immunological Methods, eds. Lefkovits and Pernis, Academic Press Inc., vol. IV, pp 121-152 (1990). .
Serrano, et al., J. Mol. Biol., vol. 233, pp. 305-312 (1993). .
Steipe, et al., J. Mol. Biol., vol. 240, pp. 188-192 (1994). .
Mullaney, et al., Appl. Microbiol Biotechnol., vol. 35, pp. 611-614 (1991). .
Lee C., et al., Science, vol. 239, pp. 1288-1291 (1988). .
Conneely et al., Biotechnology in the Feed Industry, T.P. Lyons (ed.), Alltech Technical Publications, pp. 57-66 (1992). .
Neurath et al., The Proteins, Academic Press, New York, p. 14 (1979). .
Nunes, C., Biol. Abstr., vol. 98 (10) Ref. No. 126043 (1994). Abstract. .
Segueilha et al., J. Fermentation and Bioeng., vol. 74 (1), pp. 7-11 (1992). .
Yamada et al., Agr. Biol. Chem., vol. 32, No. 10, pp. 1275-1282 (1968). .
Pen et al., Bio/Technology, vol. 11, pp. 811-814 (1993). .
Yamamoto et al., Agr. Biol. Chem., vol. 36 (12), pp. 2097-2103 (1972). .
Shieh et al., Appl. Microbiol., vol. 16, No. 9, pp. 1348-1351 (1968). .
Ullah, et al., "Identification of Active-Site Residues in Aspergillus ficuum Extracellular pH 2.5 Optimum Acid Phosphatase," Biochemical and Biophysical Research Communications, vol. 192, No. 2, pp. 754-759 (1993). .
Derwent English language abstract of DE 1 492 060 (document B12) (1969). .
Derwent accession no. XP-002120048, English language abstract of JP 09 065877 (1997). .
Khare, et al., "Entrapment of Wheat Phytase in Polyacrylamide Gel and its Application in Soymilk Phytase Hydrolysis," Biotechnol App. Biochem., vol. 19, pp. 193-198 (1994)..~
Primary Examiner: Achutamurthy; Ponnathapu
Assistant Examiner: Tung; Peter
Attorney, Agent or Firm:Bryan Cave LLP

Claims


What is claimed is:
1. A modified Aspergillus fumigatus phytase with a specific activity improved over the specific activity of the corresponding unmodified Aspergillus fumigatus phytase wherein the amino acid sequence of the unmodified phytase has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger (SEQ ID NO:1), as identified by PILEUP version 8 amino acid sequence alignment program, to an amino acid selected from the group consisting of Ala, Val, Leu, Ile, Thr, Gly, and Asn.

2. A modified Aspergillus fumigatus phytase according to claim 1, further comprising an additional mutation selected from the group consisting of S66D, S140Y, D141G, A205E, Q274L, G277D, G277K, Y282H, and N340S.

3. A modified Aspergillus fumigatis phytase with a specific activity improved over the specific activity of the corresponding unmodified Aspergillus fumigatus phytase wherein the amino acid sequence of the modified Aspergillus fumigatus phytase has a mutation selected from the group consisting of S66D, S140Y, D141G, A205E, Q274L, G277D, G277K, Y282H, N340S, and combinations therof, wherein the respective amino acid position of each mutation corresponds to the amino acid position of an Aspergillus niger phytase (SEQ ID NO:1) as identified by PILEUP version 8 amino acid alignment program.

4. A modified phytase according to claim 1 wherein the unmodified phytase has the sequence of SEQ ID NO:3.

5. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Ala.

6. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Val.

7. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Leu.

8. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Ile.

9. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Thr.

10. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Asn.

11. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been changed at a position corresponding to position 27 of the phytase of Aspergillus niger to the amino acid Gly.

12. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: Q23L and S62D.

13. A modified phytase according to claim 4 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: Q23L, S136Y, and D137G.

14. A modified phytase according to claim 3 wherein the unmodified phytase has the sequence of SEQ ID NO:3.

15. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: S62D.

16. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: S136Y.

17. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: D137G.

18. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: A200E.

19. A modified phytase according to claim 3 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: Q269L.

20. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: G272D.

21. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: G272K.

22. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: Y277H.

23. A modified phytase according to claim 14 wherein the amino acid sequence of SEQ ID NO:3 has been modified as follows: N335S.

24. A food or feed composition comprising a modified phytase of claim 1.

Description

BACKGROUND OF THE INVENTION

Phytases (myo-inositol hexakisphosphate phosphohydrolases; EC 3.1.3.8) are enzymes that hydrolyze phytate (myo-inositol hexakisphosphate) to myo-inositol and inorganic phosphate and are known to be valuable feed additives.

A phytase was first described in rice bran in 1907 [Suzuki et al., Bull. Coll. Agr. Tokio Imp. Univ. 7, 495 (1907)] and phytases from Aspergillus species in 1911 [Dox and Golden, J. Biol. Chem. 10, 183-186 (1911)]. Phytases have also been found in wheat bran, plant seeds, animal intestines and in microorganisms [Howsen and Davis, Enzyme Microb. Technol. 5, 377-382 (1983), Lambrechts et al., Biotech. Lett. 14, 61-66 (1992), Shieh and Ware, Appl. Microbiol. 16, 1348-1351 (1968)].

The cloning and expression of the phytase from Aspergillus niger (ficuum) has been described by Van Hartingsveldt et al., in Gene, 127, 87-94 (1993) and in European Patent Application, Publication No. (EP) 420 358 and from Aspergillus niger var. awamori by Piddington et al., in Gene 133, 55-62 (1993).

Cloning, expression and purification of phytases with improved properties have been disclosed in EP 684 313. However, since there is a still ongoing need for further improved phytases, especially with respect to the activity properties, it is an object of the present invention to provide such improvements.

SUMMARY OF THE INVENTION

Accordingly, this invention is directed to a process for the production of a modified phytase with a desired property improved over the property of the corresponding unmodified phytase which comprises:

(a)determining the three dimensional structure of the unmodified phytase and of a second phytase which has the desired property by aligning the amino acid sequences of said phytases with the amino acid sequence of a third phytase which is the phytase of Aspergillus niger and using the three dimensional structure of the phytase of Aspergillus niger as a template based on the alignment to determine said three dimensional structures;

(b)determining from the structures of step (a) the amino acids of the active sites of the unmodified phytase and of the second phytase having the desired property which active site provides the desired property and comparing the amino acids which form the active sites to identify which amino acids are different in the active site of the second phytase from the amino acids in the active site of the unmodified phytase;

(c)constructing a DNA sequence coding for the modified phytase by obtaining the DNA sequence of the unmodified phytase and changing the nucleotides coding for the active site which provides the desired property for said unmodified phytase so that at least one of the amino acids in the active site which provides the desired property is substituted by one of the amino acids which was identified as being different in step (b);

(d)integrating such a DNA sequence into a vector capable of expression in a suitable host cell; and

(e)transforming the suitable host cell by the DNA sequence of step (c) or the vector of step (d), growing said host cell under suitable growth conditions and isolating the modified phytase from the host cell or the culture medium.

Either or both of the unmodified phytase and the phytase with the desired property may be of eukaryotic origin, especially of fungal origin. Such phytases are preferably of Aspergillus origin, for example phytase from Aspergillus fumigatus. In a preferred process, the phytase with the desired property is a phytase from Aspergillus terreus. In another preferred process, the unmodified phytase is a phytase of Aspergillus fumigatus and the phytase with the desired property is the Aspergillus niger phytase. In yet another preferred process, the unmodified phytase is a phytase of Aspergillus fumigatus and the phytase with the desired property is the Aspergillus terreus phytase.

Also part of this invention is a modified phytase with a specific activity improved over the specific activity of the corresponding unmodified phytase (for example Aspergillus fumigatus) wherein the amino acid sequence of the corresponding unmodified phytase has been changed by one or more of deletion, substitution and addition by one or more amino acids to obtain the amino acid sequence of the modified phytase. A preferred phytase has an amino acid sequence homologous to that of the phytase of Aspergillus niger (SEQ ID NO. 1 and has an amino acid sequence that has been changed in at least one amino acid position selected from the following amino acid positions which correspond to positions of the amino acid sequence of the phytase of Aspergillus niger: 27, 66, 71, 103, 140, 141, 188, 205, 234, 235, 238, 274, 277, 282, 340 and 424, in particular wherein the amino acid position is selected from 27, 66, 140, 205, 274, 277, 282, and 340.

A preferred modified phytase has an amino acid sequence which has been changed at position 27 alone or in addition to other of the above positions, in particular at least at position 66 and/or position 140. Thus preferred phytases are modified at position 27 and 66 or 27 and 140.

For any such phytase, the amino acid at position 27 may be replaced by a specific amino acid selected from one of the following groups:

a) Ala, Val, Leu, Ile; or b)Thr; or c) Asn.

Particular modified phytases of this invention are characterized by at least one of the following changes in amino acids at positions: Q27L, Q27N, Q27T, Q27I, Q27V, Q27A, Q27G, S66D, S140Y, D141G, A205E, Q274L, G277D, G277K, Y282H and/or N340S.

Also part of this invention are polynucleotides comprising a DNA sequence coding for the modified phytases produced by the above method. Polynucleotides comprising DNA sequences coding for the phytases described above which are modified at particular amino acid positions are included.

Also included are vectors, especially expression vectors, which contain the polynucleotides of this invention, and host cells which contain these polynucleotides directly or within a vector.

Another aspect of this invention is a food or feed composition which contains modified phytases described above.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: Primary sequence alignment of A. niger (ficuum), (SEQ ID NO:1) A. terreus cbs116.46 (SEQ ID NO:2) and A. fumigatus [ATCC 13073] (SEQ ID NO:3) phytase. Stars show identical residues within the active site and rectangles, non-identical residues within the active site.

FIG. 2: pH optima curves. Specific activity of wild-type and mutant A. fumigatus phytases is plotted against pH of incubation. Filled squares represent A. fumigatus wild-type phytase; Open triangles represent A. fumigatus Q27L mutant; Filled circles represent A. fumigatus Q27L, Q274L mutant; Open squares represent A. fumigatus Q27L, Q274L, G277D mutant.

FIG. 3: Substrate specificities of wild-type and mutant A. fumigatus phytases. (A) wild-type; (B) Q27L single mutant; (C) Q27L, Q274L, G277D triple mutant. The following substrates were used: (1) phytic acid; (2) p-nitrophenyl phosphate; (3) fructose-1,6-bisphosphate; (4) fructose-6-phosphate; (5) glucose-6-phosphate; (6) ribose-5-phosphate; (7) .alpha.-glycerophosphate; (8) .beta.-glycerophosphate; (9) 3-phosphoglycerate; (10) phosphoenolpyruvate; (11) AMP; (12) ADP; (13) ATP.

FIG. 4: Complete coding sequence and encoded amino acid sequence of the Aspergillus nidulans phytase (SEQ ID NOS:4-6).

FIG. 5: Complete coding sequence (SEQ ID NO:7) and encoded amino acid sequence (SEQ ID NOs:8-9) of Talaromyces thermophilus phytase.

FIG. 6: Complete coding sequence (SEQ ID NO:10) and encoded amino acid sequence (SEQ ID NOs:11-12) of Aspergillus fumigatus [ATCC 13073] phytase.

FIG. 7: Complete coding sequence (SEQ ID NO:13) and encoded amino acid sequence (SEQ ID NOs:14-15) of Aspergillus terreus CBS 116.46 phytase.

FIG. 8: Crystallographic data of the structure of the Aspergillus niger phytase.

FIG. 9: Substrate specificities of wild-type and mutant A. fumigatus phytase (N1-N6). Substrates 1 to 13 are as indicated for FIG. 3.

FIG. 10: pH optima curves of further mutant A. fumigatus phytases (N1-N6). All activity values were standardized (maximum activity=1.0).

FIG. 11a: Stereo picture of the three-dimensional fold of A. niger (A. ficuum; NRRL 3135) phytase. The active site is indicated with a circle and the catalytically essential amino acid residues Arg 58 and His 59 are shown in ball-and-stick representation. This figure was prepared with the programs "MOLSCRIPT" [Kraulis, P. J., J. Appl. Cryst. 24, 946-950 (1991)] and "RASTER3D" [Merritt, E. A. & Murphy, M. E. P., Acta Cryst., 869-873 (1994)].

FIG. 11b: Topological sketch, using the same scheme as in (a). The five disulphide bridges are shown as black zigzag lines together with the sequence numbers of the cysteine residues involved. The .beta.-strands are defined with the sequence numbers A:48-58, B:134-138, C: 173-177, D: 332-337, E: 383-391, and F: 398-403. The .alpha.-helices are defined with the sequence numbers a: 66-82, b: 88-95, c: 107-123, d: 141-159, e: 193-197, f: 200-210, g: 213-223, h: 231-246, i: 257-261, 264-281, k:
290-305,l: 339-348, m: 423-429, and n: 439-443. The asterisk at the C-terminal end of .beta.-strand A marks the location of the catalytically essential amino acid residues Arg 58 and His 59.

FIG. 12: Stereo picture of the active site of A. ficuum (ATCC 13073) phytase with a hypothetical binding mode of the substrate phytate. In this model, the bound crystal water molecules were removed and the protein atom positions were held fixed, except for small adaptations of the side chain torsion angles of Lys 68 in order to interact with the substrate. All the conserved amino acid residues Arg 58, His 59, Arg 62, Arg 142, His 338 and Asp 339 form hydrogen bonds to the scissile 3-phosphate group of phytate, as indicated with lines of small dots. His 59 is in a favorable position to make a nucleophilic attack at the scissile phosphorous, indicated with a line of larger dots, and Asp 339 is in a position to protonate the leaving group.

FIG. 13: Construction of the basic plasmids pUC18-AfumgDNA and pUC18-AfumcDNA for site directed mutagenesis.

FIG. 14a: Primer sets A-N (SEQ ID NOs:24-65)used for site directed mutagenesis.

FIG. 14b: Primer sets O-T (SEQ ID NOs:66-77) used for site directed mutagenesis.

FIG. 15: Construction of plasmids pgDNAT1-pgDNAT7.

FIG. 16: Construction of plasmids pgDNAN1-pgDNAN6.

FIG. 17a: Construction of plasmids pcT1-pcT7.

FIG. 17b: Construction of plasmids pcT1-AvrII, pcT1-S66D and pcT1-S140Y-D141G

FIG. 17c: Construction of plasmids pcDNA-N27, -T27, -I27, -V27, -A27, -G27 .

FIG. 18: Construction of plasmids pcN1-pcN6.

FIG. 19: Plasmid pAfum-T1 for the expression of mutein T1 in Aspergillus niger.

FIG. 20: pH optima curves. Specific activity of wild-type and mutant A. fumigatus phytases is plotted against pH of incubation.

Open triangles: A. fumigatus [ATCC 13073] wild-type phytase; Open rhombs: A. fumigatus Q27G phytase; Filled squares: A. fumigatus Q27N phytase; Filled triangles: A. fumigatus Q27V phytase; Open squares: A. fumigatus Q27A phytase; Filled circles: A. fumigatus Q27I phytase; Open circles: A. fumigatus Q27T phytase; Dashed line: A. fumigatus Q27L phytase.

FIG. 21: Substrate specificities of wild-type and mutant A. fumigatus [ATCC 13073] phytases. The used substrates 1-13 are the same as mentioned in FIG. 3.

The specific activities of the different phytases with any one of the 13 substrates tested are given in the following order (from left to right): A. fumigatus wild-type phytase, A. fumigatus Q27N phytase, A. fumigatus Q27T phytase, A. fumigatus Q27L phytase, A. fumigatus Q27I phytase, A. fumigatus Q27V phytase, A. fumigatus Q27A phytase, A. fumigatus Q27G phytase.

FIG. 22: pH optima curves. Specific activity of wild-type and mutant A. fumigatus [ATCC 13073] phytases is plotted against pH of incubation.

Filled rhombs: A. fumigatus wild-type phytase; Filled squares: A. fumigatus Q27L single mutant; Open circles: A. fumigatus Q27L-S66D double mutant; Filled triangles: A. fumigatus Q27L-S14OY-D141G triple mutant.

FIG. 23: Natural variation of phytases in different isolates of A. fumigatus [ATCC 13073]. The predicted protein sequences (SEQ ID NO:78-82) are shown and compared to that of the phytase from A. fumigatus strain ATCC 13073. Only the amino acids which differ from those in #13073 are shown.

FIG. 24: pH dependent specific activity of phytases isolated from two different A. fumigatus wildtype strains. Open squares: wild-type strain ATCC 13073; Filled circles: strain ATCC 32239.

FIG. 25: Substrate specificities of phytases isolated from two different A. fumigatus wildtype strains. Black bars: wild-type strain ATCC 13073; White bars: strain ATCC 32239.

FIG. 26: Construction of plasmids pc-S13ON, pc-R129L-S13ON, pc-K167G-R168Q.

DETAILED DESCRIPTION OF THE INVENTION

The process of this invention allows the production of a modified phytase with improved activity by using structural information about phytases to design the improvement. First, the three dimensional structure of the phytase to be modified and, optionally of another phytase with activity properties which are more favorable than the ones of the phytase to be modified is/are computer modelled on the basis of the three dimensional structure of the phytase of Aspergillus niger (ficuum). Then, the structure of the active sites of the phytase to be modified and of the phytase with the more favorable activity properties are compared and those amino acid residues in both active sites which are different are identified, after which a DNA sequence coding for a modified phytase is constructed by changing the nucleotides coding for at least one of the amino acids by which both active sites differ. The modified phytase is then obtained by integrating such a DNA sequence into a vector capable of expression in a suitable host cell, transforming a suitable host cell by the DNA sequence or the vector, growing the host cell under suitable growth conditions and isolating the modified phytase from the host cell or the culture medium by methods known in the state of the art.

As stated above, this process is particularly useful where the phytase to be modified is of eukaryotic, preferably fungal, more preferably Aspergillus, e.g. Aspergillus fumigatus origin and the phytase with more favorable activity properties is of eukaryotic, preferably fungal, more preferably Aspergillus, e.g. Aspergillus niger or Aspergillus terreus (Aspergillus terreus cbs 116.46 or 9A1) origin, or the phytase to be modified is a phytase of Aspergillus fumigatus and the phytase with the more favorable activity properties is the Aspergillus terre us phytase or the phytase of Aspergillus niger.

Thus, the unmodified phytase (for example a wild-type phytase) which has a property to be improved, and the phytase which has that property in an improved version (i.e. the desired property which the modified phytase will be designed to possess) may be derived from any known source of phytases. Various plants and microorganisms are known to produce phytases [e.g. reviewed in Wodzinski, R. J. and Ullah, H. J., Advances in Applied Microbiology 42, 263 (1996)]. Thus any enzyme which may be isolated by conventional methods and determined to be a phytase by standard assays (see e.g. EP 420 358) is a suitable phytase for this invention. Sequence and structure information for such phytases may be obtained by conventional techniques or from publicly available databases.

Preferred phytases are those isolated from fungi such as Aspergillus species [Shieh, T. R. and Ware, J. H. Appl. Microbiology 16, 1348 (1968); Yamada et al., Agr. Biol. Chem. 32, 1275 (1968);Van Hartingsveldt et al., in Gene, 127, 87-94
(1993), European Patent Application, Publication No. (EP) 420 358, Piddington et al., in Gene 133, 55-62 (1993); Wodzinski, R. J. and Ullah, H. J. (s.a.) and Mitchell et al., Microbiology 143, 245 (1997)]. Aspergillus are well known fungi commonly isolated from natural sources by conventional methods. In addition, Aspergillus species may be obtained from depositories.

Once such a fungus is obtained, DNA expressing its phytase can be isolated by conventional methods [see Mitchell et al., Microbiology 143:245 (1997) Van Hartingsweldt et al. (s.a.); Dox and Golden (s.a.); EP 420 358; Piddington et al (s.a.) and WO 94/03612] (for example cloned, expressed, and assayed by phytase activity assays to obtain a clone expressing the phytase) for use in this invention. Specifically, the phytase DNA can be used to isolat the phytase, whose amino acid sequence and three-dimensional structures can also be obtained by known methods, such as crystallography or computer modelling. Alternatively, the phytase may be isolated by conventional methods for isolating proteins such as enzymes, and analyzed as described. Also, DNA and amino acid sequences may be obtained from publicly available databases.

Although other three-dimensional phytase structures may be obtained and used, it is preferred to use the three-dimensional of the Aspergillus niger phytase in the process of this invention (see Kostrewa et al., Nature Structural Biology 4:185
(1997) or of Aspergillus fumigatus. A useful strain of Aspergillus niger may be obtained from the American Type Culture Collection [address] under accession number ATCC 9142. Like any three-dimensional phytase structure useful in this invention, the three-dimensional structure of the A. niger phytase is obtained by techniques known to a skilled practitioner. Based on an amino acid sequence such as the A. niger amino acid sequence provided herein, (SEQ ID NO:1) computer programs can provide theoretical structures. Crystal structures can also be obtained, as in Example 1 below. From these three-dimensional structures, active sites can be defined, such as the part of the phytase which interacts with substrate. This active site can then be localized to the segment or segments of the amino acid sequence which together form the active site, which segment or segments can then be modified, the whole sequence expressed as a modified phytase which is then tested to see if the activity has been improved. By this means a desired property can be designed into an unmodified phytase, using the three dimensional structure of the A. niger phytase as a template based on the alignment.

Specifically, the structure of A. niger is analyzed to find out which amino acid residues form the active site which determines specific activity. Then, the amino acid sequence of an unmodified phytase with a given specific activity and that of a phytase which has a desired property, e.g. a higher specific activity, are aligned homologous (as defined below) to that of A. niger to provide a best fit, and the amino acid residues which correspond to the A. niger active site in the other phytases are determined and compared, to identify which amino acids are different in the active site of the phytase with the desired property. The active site amino acid residues of the unmodified phytase may then be changed by known methods to duplicate some or all of the active site amino acid residues of the phytase with the desired property. The modified phytase is then obtained by known methods (for example determining the DNA sequence, mutating the sequence to provide the desired amino acid sequence, and expressing the resulting protein), and is tested by assays for the desired property, e.g. specific activity, to confirm that the desired property is present.

In this context it should be mentioned that another possibility for producing phytases with improved properties is by isolating phytases from the same organism, like for example the Aspergillus ficuum, but different strains which can be found in nature and have been deposited by any of the known depository authorities. Their amino acid sequences can be determined by cloning their corresponding DNA sequences by methods as described, e.g. in European Patent Application No. (EP) 684 313. Once such sequences have been defined they can be modeled on the basis of the three-dimensional structure of the A. niger phytase and the active sites of both sequences can be compared to find out whether such phytase should have improved activity properties (see Example 8) or both active site sequences can be compared directly and than tested for increased and/or improved activity by the assays described in the present application.

It is furthermore an object of the present invention to provide a modified phytase which is obtainable by a process as described above.

It is in general an object of the present invention to provide a phytase which has been modified in a way that its activity property is more favorable than the one of the non-modified phytase, specifically such a phytase characterized therein that the amino acid sequence of the non-modified phytase has been changed by deletion, substitution and/or addition of one or more amino acids, more specifically such a phytase wherein changes have been made at at least one position which is homologous to one of the following positions of the amino acid sequence of the phytase of Aspergillus (A.) niger (see FIG. 1): 27, 66, 71, 103, 140, 141, 188, 205, 234, 235, 238, 274, 277, 282, 340 and/or 424, preferably 27, 66, 140, 205, 274, 277, 282 and/or 340, and even more specifically such a phytase which is the phytase of eukaryotic, preferably fungal, more preferably Aspergillus and most preferably Aspergillus fumigatus, origin.

It is furthermore an object of the present invention to provide such a phytase wherein at position 27 or at least at position 27 a change occurs, preferably a phytase wherein the amino acid at position 27 is replaced by one selected from one of the following groups:

a) Ala, Val, Leu, Ile; or

b) Thr or

c) Asn; and furthermore such a phytase wherein in addition to position 27 a change occurs also at position 66 or wherein in addition to position 27 a change occurs also at position 140 and/or at positions 274 and/or 277.

It is also an object of the present invention to provide a phytase as specified above which is characterized by at least one of the following mutations: Q27L, Q27N, Q27T, Q27I, Q27V, Q27A, Q27G, S66D, S140Y, D141G, A205E, Q274L, G277D, G277K, Y282H and/or N340S.

It is furthermore an object of the present invention to provide phytase muteins which are resistant against degradation by proteases of fungal, preferably Aspergillus and most preferably Aspergillus niger (ficuum) origin. Such muteins are characterized therein that at least at one of the following positions (which refers to the homologous position in the amino acid sequence of A. niger), namely position 130 or 129 and 130, preferably of the Aspergillus fumigatus or 167, 168 preferably of the A. nidulans phytase amino acid sequence, the amino acid which is present in the wild type sequence has been replaced against another amino acid which is known to change the protease sensitivity, e.g. in the case of A. fumigatus at position 130 from "S" to "N" and at position 129 from "R" to "L" and in case of A. nidulans at position 167 from "K" to "G" and at position 168 from R to Q. Such positions can be also combined with those providing for improved activity properties.

A desired property to be integrated into an unmodified phytase by sequence modification as described herein, may be a new property not present in the unmodified phytase, or may preferably be an existing property of the unmodified phytase which is to be improved, for example a specific activity over a broader pH range than in the unmodified phytase. The active site of the phytases is the part of the phytase which is the physical structure which provides all or part of the property. For example the binding site of the phytase provides the property of substrate specificity. Other parts of the phytase may have an influence on a given property, however the active site is the part which changes the property upon modification as described.

In this context a desired property which is to be improved, or an improved activity property means any type of improvement of the activity of the modified phytase as compared to the unmodified. This could mean for example a higher specific activity, preferably at least two fold or more preferably at least 3 to 4 fold higher in an assay known in the state of the art to measure phytase activity, see e.g. in EP 684 313 or described in the examples of the present application. Furthermore this could mean a different substrate specificity determined in an assay known in the state of the art or as described e.g. in the specific examples of the present invention. This could also mean a maximum of the specific activity at a different more favorable pH or a broad pH optimum ("improved pH profile") determined by an assay as known in the state of the art or as described e.g. in the examples. This also could mean improved resistance to protease degradation, as described above. Finally this could also mean any combination of such properties.

"Homologous" in the context of the present invention means the best fit of the primary, preferably also secondary and most preferably also tertiary structure of the phytase to be modified and the phytase of Aspergillus niger. How such best fit can be obtained is described in detail in Example 1 of the present invention. FIG. 1 gives an example of such best fit for the phytase amino acid sequences of Aspergillus fumigatus and Aspergillus terreus aligned on the basis of the Aspergillus niger amino acid sequence which latter sequence is also used as the reference to which the positions of the other sequences, e.g. the ones named before, are referred to. Furthermore the modified Aspergillus fumigatus phytase with the Q27L mutation, means nothing else than the phytase of Aspergillus fumigatus wherein at position 27 according to the assignment as defined above (which is in fact position 23 of the Aspergillus fumigatus amino acid sequence) the naturally occurring glutamine ("Q" refers to the standard UPAC one letter amino acid code) has been replaced by leucine ("L"). All muteins of the present invention are designated in this way independent from whether they are protease resistant muteins or muteins with improved activity properties.

Constructing a polynucleotide comprising a DNA sequence coding for the modified phytase whose amino acid sequence was obtained as described above is performed by known methods such as those described below. The nucleotides coding for the active site which provides the desired property are changed so that at least one of the amino acids now encoded corresponds to an amino acid which is different in the active site of the unmodified phytase and the active site of the phytase which has the desired property. Integrating such a polynucleotide into vectors and host cells so as to express the modified phytase is also part of this invention and may be accomplished by known methods and as described below.

Thus it is furthermore an object of the present invention to provide a polynucleotide comprising a DNA sequence coding for a phytase as described above, a vector, preferably an expression vector, comprising such a polynucleotide, a host cell which has been transformed by such a polynucleotide or vector, a process for the preparation of a phytase of the present invention wherein the host cell as described before is cultured under suitable culture conditions and the phytase is isolated from such host cell or the culture medium by methods known in the art, and a food or feed composition comprising a phytase of the present invention.

In this context it should be noted that it is also an object of the present invention to provide a DNA sequence which codes for a phytase carrying at least one of the specific mutations of the present invention and which hybridizes under standard conditions with the DNA sequences of the specific modified phytases of the present invention or a DNA sequence which, because of the degeneracy of the genetic code does not hybridize but which codes for a polypeptide with exactly the same amino acid sequence as the one encoded by the DNA sequence to which it does not hybridize or a DNA sequence which is a fragment of such DNA sequences which maintains the activity properties of the polypeptide of which it is a fragment.

"Standard conditions" for hybridization mean in the context the conditions which are generally used by a person skilled in the art to detect specific hybridization signals and which are described, e.g. by Sambrook et al., "Molecular Cloning", second edition, Cold Spring Harbor Laboratory Press 1989, New York, or preferably so called stringent hybridization and non-stringent washing conditions or more preferably so called stringent hybridization and stringent washing conditions a person skilled in the art is familiar with and which are described, e.g. in Sambrook et al. (s.a.).

It is furthermore an object of the present invention to provide a DNA sequence which can be obtained by the so called polymerase chain reaction method ("PCR") by PCR primers designed on the basis of the specifically described DNA sequences of the present invention. It is understood that the so obtained DNA sequences code for phytases with at least the same mutation as the ones from which they are designed and show comparable activity properties.

The principles of the polymerase chain reaction (PCR) method are outlined e.g. by White et al., Trends in Genetics, 5, 185-189 (1989), whereas improved methods are described e.g. in Innis et al. [PCR Protocols: A guide to Methods and Applications, Academic Press, Inc. (1990)].

DNA sequences of the present invention can be constructed starting from genomic or cDNA sequences coding for phytases known in the state of the art [for sequence information see references mentioned above, e.g. EP 684 313 or sequence data bases, for example like Genbank (Intelligenetics, California, USA), European Bioinformatics Institute (Hinston Hall, Cambridge, GB), NBRF (Georgetown University, Medical Centre, Washington DC, USA) and Vecbase (University of Wisconsin, Biotechnology Centre, Madison, Wis., USA) or disclosed in the figures by methods of in vitro mutagenesis [see e.g. Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York]. A widely used strategy for such "site directed mutagenesis", as originally outlined by Hurchinson and Edgell [J. Virol. 8, 181 (1971)], involves the annealing of a synthetic oligonucleotide carrying the desired nucleotide substitution to a target region of a single-stranded DNA sequence wherein the mutation should be introduced [for review see Smith, Annu. Rev. Genet. 19, 423 (1985) and for improved methods see references 2-6 in Stanssen et al., Nucl. Acid Res., 17, 4441-4454 (1989)]. Another possibility of mutating a given DNA sequence which is also preferred for the practice of the present invention is the mutagenesis by using the polymerase chain reaction (PCR). DNA as starting material can be isolated by methods known in the art and described e.g. in Sambrook et al. (Molecular Cloning) from the respective strains. For strain information see, e.g. EP 684 313 or any depository authority indicated below. Aspergillus niger [ATCC 9142], Myceliophthora thermophila [ATCC 48102], Talaromyces thermophilus [ATCC 20186] and Aspergillus fumigatus [ATCC 34625] have been redeposited on Mar. 14, 1997 according to the conditions of the Budapest Treaty at the American Type Culture Cell Collection under the following accession numbers: ATCC 74337, ATCC 74340, ATCC 74338 and ATCC 74339, respectively. It is however, understood that DNA encoding a phytase to be mutated in accordance with the present invention can also be prepared on the basis of a known DNA sequence, e.g. as shown in FIG. 6 in a synthetic manner and described e.g. in EP 747 483 by methods known in the art.

Once complete DNA sequences of the present invention have been obtained they can be integrated into vectors by methods known in the art and described e.g. in Sambrook et al. (s.a.) to overexpress the encoded polypeptide in appropriate host systems. However, a man skilled in the art knows that also the DNA sequences themselves can be used to transform the suitable host systems of the invention to get overexpression of the encoded polypeptide. Appropriate host systems are for example fungi, like Aspergilli, e.g. Aspergillus niger [ATCC 9142] or Aspergillus ficuum [NRRL 3135] or like Trichoderma, e.g. Trichoderma reesei or yeasts, like Saccharomyces, e.g. Saccharomyces cerevisiae or Pichia, like Pichia pastoris, or Hansenula polymorpha, e.g. H. polymorpha (DSM5215). A man skilled in the art knows that such microorganisms are available from depository authorities, e.g. the American Type Culture Collection (ATCC), the Centraalbureau voor Schimmelcultures (CBS) or the Deutsche Sammlung fair Mikroorganismen und Zellkulturen GmbH (DSM) or any other depository authority as listed in the Journal "Industrial Property" [(1991) 1, pages 29-40]. Bacteria which can be used are e.g. E. coli, Bacilli as, e.g. Bacillus subtilis or Streptomyces, e.g. Streptomyces lividans (see e.g. Anne and Mallaert in FEMS Microbiol. Letters 114, 121 (1993). E. coli, which could be used are E. coli K12 strains e.g. M15 [described as DZ 291 by Villarejo et al. in J. Bacteriol. 120, 466-474
(1974)], HB 101 [ATCC No. 33694] or E. coli SG13009 [Gottesman et al., J. Bacteriol. 148, 265-273 (1981)].

Vectors which can be used for expression in fungi are known in the art and described e.g. in EP 420 358, or by Cullen et al. [Bio/Technology 5, 369-376 (1987)] or Ward in Molecular Industrial Mycology, Systems and Applications for Filamentous Fungi, Marcel Dekker, New York (1991), Upshall et al. [Bio/Technology 5, 1301-1304 (1987)] Gwynne et al. [Bio/Technology 5, 71-79 (1987)], Punt et al. [J. Biotechnol. 17, 19-34 (1991)] and for yeast by Sreekrishna et al. [J. Basic Microbiol. 28,
265-278 (1988), Biochemistry 28, 4117-4125 (1989)], Hitzemann et al. [Nature 293, 717-722 (1981)] or in EP 183 070, EP 183 071, EP 248 227, EP 263 311. Suitable vectors which can be used for expression in E. coli are mentioned, e.g. by Sambrook et al. [s.a.] or by Fiers et al. in Procd. 8th Int. Biotechnology Symposium" [Soc. Franc. de Microbiol., Paris (Durand et al., eds.), pp. 680-697 (1988)] or by Bujard et al. in Methods in Enzymology, eds. Wu and Grossmann, Academic Press, Inc. Vol. 155,
416-433 (1987) and Stuber et al. in Immunological Methods, eds. Lefkovits and Pernis, Academic Press, Inc., Vol. IV, 121-152 (1990). Vectors which could be used for expression in Bacilli are known in the art and described, e.g. in EP 405 370, Procd. Natl. Acad. Sci. USA 81, 439 (1984) by Yansura and Henner, Meth. Enzymol. 185, 199-228 (1990) or EP 207 459. Vectors which can be used for the expression in H. Polymorpha are known in the art and described, e.g. in Gellissen et al., Biotechnology
9, 291-295 (1991).

Either such vectors already carry regulatory elements, e.g. promotors, or the DNA sequences of the present invention can be engineered to contain such elements. Suitable promotor elements which can be used are known in the art and are, e.g. for Trichoderma reesei the cbh1- [Haarki et al., Biotechnology 7, 596-600 (1989)] or the pkil-promotor [Schindler et al., Gene 130, 271-275 (1993)], for Aspergillus oryzae the amy-promotor [Christensen et al., Abstr. 19th Lunteren Lectures on Molecular Genetics F23 (1987), Christensen et al., Biotechnology 6, 1419-1422 (1988), Tada et al., Mol. Gen. Genet. 229, 301 (1991)], for Aspergillus niger the glaA- [Cullen et al., Bio/Technology 5, 369-376 (1987), Gwynne et al., Bio/Technology 5, 713-719
(1987), Ward in Molecular Industrial Mycology, Systems and Applications for Filamentous Fungi, Marcel Dekker, New York, 83-106 (1991)], alcA- [Gwynne et al., Bio/Technology 5, 718-719 (1987)], suc1- [Boddy et al., Curr. Genet. 24, 60-66 (1993)], aphA- [MacRae et al., Gene 71, 339-348 (1988), MacRae et al., Gene 132, 193-198 (1993)], tpiA- [McKnight et al., Cell 46, 143-147 (1986), Upshall et al., Bio/Technology 5, 1301-1304 (1987)], gpdA-[Punt et al., Gene 69, 49-57 (1988), Punt et al., J. Biotechnol. 17, 19-37 (1991)] and the pkiA-promotor [de Graaff et al., Curr. Genet. 22, 21-27 (1992)]. Suitable promotor elements which could be used for expression in yeast are known in the art and are, e.g. the pho5-promotor [Vogel et al., Mol. Cell. Biol.,
2050-2057 (1989); Rudolf and Hinnen, Proc. Natl. Acad. Sci. 84, 1340-1344 (1987)] or the gap-promotor for expression in Saccharomyces cerevisiae and for Pichia pastoris, e.g. the aoxl-promotor [Koutz et al., Yeast 5, 167-177 (1989); Sreekrishna et al., J. Basic Microbiol. 28, 265-278 (1988)], or the FMD promoter [Hollenberg et al., EPA No. 0299108] or MOX-promotor [Ledeboer et al., Nucleic Acids Res. 13, 3063-3082 (1985)] for H. polymorpha.

Accordingly vectors comprising DNA sequences of the present invention, preferably for the expression of said DNA sequences in bacteria or a fungal or a yeast host and such transformed bacteria or fungal or yeast hosts are also an object of the present invention.

Once such DNA sequences have been expressed in an appropriate host cell in a suitable medium the encoded phytase can be isolated either from the medium in the case the phytase is secreted into the medium or from the host organism in case such phytase is present intracellularly by methods known in the art of protein purification or described, e.g. in EP 420 358 Known methods of protein purification may be used to isolate the phytases of this invention. For example various types of chromatography may be used individually or in combination. Gel purification may also be used. Accordingly a process for the preparation of a polypeptide of the present invention characterized in that transformed bacteria or a host cell as described above is cultured under suitable culture conditions and the polypeptide is recovered therefrom and a polypeptide when produced by such a process or a polypeptide encoded by a DNA sequence of the present invention are also an object of the present invention.

Phytases of the present invention can be also expressed in plants according to methods as described, e.g. by Pen et al. in Bio/Technology 11, 811-814 (1994) or in EP 449 375, preferably in seeds as described, e.g. in EP 449 376.

For example, a DNA sequence encoding a phytase of the present invention can be placed under the control of regulatory sequences from the gene encoding the 12S storage protein cruciferin from Brassica napus. The construct is thereafter subcloned into a binary vector such as pMOG23 (in E. coli K-12 strain DH5.alpha., deposited at the Centraal Bureau voor Schimmelcultures, Baarn, The Netherlands under accession number CBS 102.90). This vector is introduced into Agrobacterium tumefaciens which contains a disarmed Ti plasmid. Bacterial cells containing this contruct are co-cultivated with tissues from tobacco or Brassica plants, and transformed plant cells are selected by nutrient media containing antibiotics and induced to regenerate into differentiated plants on such media. The resulting plants will produce seeds that contain and express the DNA contruct. Or the phytase-encoding DNA sequence can be placed under the control of regulatory sequences from the 35S promoter of Cauliflower Mosaic Virus (CaMV). The contruct is thereafter subcloned into a binary vector. This vector is then introduced into Agrobacterium tumefaciens which contains a disarmed Ti plasmid. Bacterial cells containing this construct are cocultivated with tissues from tobacco or Brassica plants, and transformed plant cells are selected by nutrient media containing antibiotics and induced to regenerate into differentiated plants on such media. The resulting plants contain and express the DNA construct constitutively.

The plant or plant part containing phytase can be used directly for the preparation of a feed composition or can be extracted from plants or plant organs by methods known in the art. Accordingly it is also an object of the present invention to provide a process for the production of the phytases of the present invention in plants or plant organs, like seeds, the phytases when produced by such methods, the transformed plants and plant organs, like seeds itself.

Once obtained the polypeptides of the present invention (which include modified phytases as described and active fragments thereof, and fusion proteins which include the phytases or fragments, or proteins which have stabilized by other moieties such as conjugation with polyalkylene glycols and such) can be characterized regarding their properties which make them useful in agriculture any assay known in the art and described e.g. by Simons et al. [Br. J. Nutr. 64, 525-540 (1990)], Schoner et al. [J. Anim. Physiol. a. Anim. Nutr. 66, 248-255 (1991)], Vogt [Arch. Geflugelk. 56, 93-98 (1992)], Jongbloed et al. [J. Anim. Sci., 70, 1159-1168 (1992)], Perney et al. [Poultry Sci. 72, 2106-2114 (1993)], Farrell et al., [J. Anim. Physiol. a. Anim. Nutr. 69, 278-283 (1993), Broz et al., [Br. Poultry Sci. 35, 273-280 (1994)] and Dungelhoef et al. [Animal Feed Sci. Technol. 49, 1-10 (1994)] can be used.

In general the polypeptides of the present invention can be used without being limited to a specific field of application for the conversion of inositol polyphosphates, like phytate to inositol and inorganic phosphate. For example phytases can be used to increase the nutrient value of plant material in animal feed by liberating from it inorganic phosphate which otherwise would otherwise not be accessible to non-ruminants. This reduces the amount of phosphorous which must be added to feed as a supplement and also reduces the amount of phosphorous which is excreted. Thus, phytases of this invention which have improved properties will enhance this process, or impart new benefits.

Furthermore the polypeptides of the present invention can be used in a process for the preparation of compound food or feeds wherein the components of such a composition are mixed with one or more polypeptides of the present invention. Accordingly compound food or feeds comprising one or more polypeptides of the present invention are also an object of the present invention. A person skilled in the art is familiar with their process of preparation. A phytase of this invention may be added to the complete feed preparation or to any component or premix or pelleted component. The effect of the added phytase may be an improvement in food utilization by virtue of the improved property or properties of the phytase. For example a phytase may have improved heat resistance to resist degradation caused by the food preparation process, and/or may have improved specific activity to liberate more phosphorous, and/or to liberate phosphorous in a wider range of conditions. Other properties of the modified phytase which increase the value or stability or other properties of the feed are also contemplated. Such compound foods or feeds can further comprise additives or components generally used for such purpose and known in the state of the art.

It is furthermore an object of the present invention to provide a process for the reduction of levels of phytate in animal manure characterized in that an animal is fed such a feed composition in an amount effective in converting phytate contained in the feedstuff to inositol and inorganic phosphate.

EXAMPLES

Example 1

Homology Modeling of A. fumigatus and A. terreus cbs116.46 Phytase

The amino acid sequences of A. fumigatus [ATCC 13073] (see FIG. 1) and A. terreus cbs116.46 phytase (see FIG. 1) were compared with the sequence of A. niger (ficuum) phytase (see FIG. 1) for which the three-dimensional structure had been determined by X-ray crystallography. Crystallographic data are given in FIG. 8.

A multiple amino acid sequence alignment of A. niger (ficuum) phytase, A. fumigatus phytase and A. terreus cbs116.46 phytase was calculated with the program "PILEUP" (Prog. Menu for the Wisconsin Package, version 8, September 1994, Genetics Computer Group, 575 Science Drive, Madison Wis., USA 53711). The three-dimensional models of A. fumigatus phytase and A. terreus cbs116.46 phytase were built by using the structure of A. niger (ficuum) phytase as template and exchanging the amino acids of A. niger (ficuum) phytase according to the sequence alignment to amino acids of A. fumigatus and A. terreus cbs116.46 phytases, respectively. Model construction and energy optimization were performed by using the program Moloc (Gerber and Muller,
1995). C-alpha positions were kept fixed except for new insertions/deletions and in loop regions distant from the active site.

Only small differences of the modelled structures to the original crystal structure could be observed in external loops. Furthermore the different substrate molecules that mainly occur on the degradation pathway of phytic acid (myo-inositol-hexakisphosphate) by Pseudomonas sp. bacterium phytase and, as far as determined, by A. niger (ficuum) phytase (Cosgrove, 1980; FIG. 1) were constructed and forged into the active site cavity of each phytase structure. Each of these substrates was oriented in a hypothetical binding mode proposed for histidine acid phosphatases (Van Etten, 1982). The scissile phosphate group was oriented towards the catalytically essential His 59 to form the covalent phosphoenzyme intermediate. The oxygen of the substrate phosphoester bond which will be protonated by Asp 339 after cleavage was orientated towards the proton donor. Conformational relaxation of the remaining structural part of the substrates as well as the surrounding active site residues was performed by energy optimization with the program Moloc.

Based on the structure models the residues pointing into the active site cavity were identified. More than half (60%) of these positions were identical between these three phytases, whereas only few positions were not conserved (see FIG. 1). This observation could be extended to four additional phytase sequences (A. nidulans, A. terreus 9A1, Talaromyces thermophilus, Myceliophthora thermophila).

The results coming from sequence alignment and structural information including favourable enzyme-substrate interactions were combined to define the positions for mutational analysis which are shown in Table 1.

References

Gerber, P. and Muller, K. (1995) Moloc molecular modeling software. J. Comput. Aided Mol. Des. 9, 251-268

Van Etten, R. L. (1982) Human prostatic acid phosphatase: a histidine phosphatase. Ann. NY Acad. Sci. 390,27-50

Cosgrove, D. J. (1980) Inositol phosphates--their chemistry, biochemistry and physiology: studies in organic chemistry, chapter 4. Elsevier Scientific Publishing Company, Amsterdam, Oxford, N.Y.

Example 2

Construction of Plasmids pUC18-AfumgDNA and pUC18-AfumcDNA

Plasmids pUC18-AfumgDNA and pUC18-AfumcDNA, the basic constructs for all the A. fumigatus muteins described below were constructed as follows.

pUC18-AfumgDNA: The genomic DNA sequence of the phytase gene of Aspergillus fumigatus was obtained by PCR using the "Expand.TM. High Fidelity PCR Kit" (Boehringer Mannheim, Mannheim, Germany) with primers #39 and #40 (designed on the basis of the genomic sequence shown in FIG. 6) and genomic DNA of Aspergillus fumigatus [ATCC 13073] from the A. fumigatus (NIH stock 5233) genomic library in a Lambda FixII vector [Stratagene, Lugolla, Calif. 92037, USA; catalog No. 946055].

Primer #39:

BspHI 5' TAT ATC ATG ATT ACT CTG ACT TTC CTG CTT TCG 3' (SEQ ID NO:16) M I T L T F L L S (SEQ ID NO:17)

Primer #40:

EcoRV 3' CCT CTC ACG AAA TCA ACT CTA TAG ATA TAT 5' (SEQ ID NO:8) G E C F S * (SEQ ID NO:19)

The reaction mix included 10 pmol of each primer and 200 ng of template DNA. 35 rounds of amplification were done with the following cycling values: 95.degree. C., 1 min/56.degree. C., 1 min/72.degree. C., 90 sec. The PCR-amplified Aspergillus fumigatus mutein genes had a new BspHI site at the ATG start codon, introduced with primer #39, which resulted in the change of the second amino acid from a valine to an isoleucine. Furthermore, an EcoRV site was created with primer #40
downstream of the TGA termination codon of the gene.

The PCR fragment (approx. 1450 bp) was subsequently cloned into the Smal site of pUC18 using the "sure clone Kit" (Boehringer Mannheim s.a.) according to the supplier's recommendations. The resulting plasmid was named pUC18-AfumgDNA.

pUC18-AfumcDNA: This plasmid lacks the intron (small gap letters in FIG. 6) of the A. fumigatus phytase gene and was constructed as outlined in FIG. 13. Briefly, using primers Fum28 and Fum11 the 5' end of exon 2 was amplified by PCR (see below), digested with NcoI and EagI (new restriction site introduced with primer Fum28) and ligated together with the linker coding for exon 1 made of primers Fum26 and Fum27 into the XbaI and NcoI sites of pUC18-AfumgDNA, thereby resulting in plasmid pUC18-AfumcDNA.

Fum28:

(SEQ ID NO:20) 5' ATATATCGGCCGAGTGTCTGCGGCACCTAGT 3' EagI

Fum11:

5' TGAGGTCATCCGCACCCAGAG 3' (SEQ ID NO:20)

Fum26:

5' CTAGAATTCATGGTGACTCTGACTTTCCTGCTTTCGGCGGCGTATCT GCTTTCC 3'(SEQ ID NO:22)

Fum27:

5' GGC C GGAAAGCAGATACGCCGCCGAAAGCAGGAAAGTCAGAGTC ACCATGAATT 3' (SEQ ID NO:23)

PCR reaction to get 5' end of exon 2 of the A. fumigatus phytase:

2 .mu.l template: pUC18-AfumgDNA (20 ng) 1 .mu.l dNTP's-mix (Boehringer Mannheim s.a.) 5 .mu.l l0.times. Buffer 1 .mu.l Taq polymerase (Boehringer Mannheim s.a.) 1.9 .mu.l Fum11 (= 10 pmol) 2 .mu.l Fum28 (= 10 pmol) 37,1 .mu.l H.sub.2 O

In total 35 cycles with the temperature profile: 95.degree. C. for 30 sec/56.degree. C. for 30 sec/72.degree. C. for 45 sec were made. The amplified fragment (approx. 330 bp) was extracted once with an equal volume of phenol/chloroform (1:1). To the recovered aqueous phase 0.1 volume of 3 M sodium acetate, pH 4.8 and 2.5 volumes of ethanol were added. The mixture was centrifuged for 10 min at 12000 g and the pellet resuspended in 20 .mu.l of H.sub.2 O. Subsequently, the purified fragment was digested with NcoI and EagI and processed as outlined above.

Example 3

Construction of Muteins of the Phytase of Aspergillus fumigatus for Expression in A. niger

To construct all muteins for the expression in A. niger, plasmid pUC18-AfumgDNA was used as template for site-directed mutagenesis. Mutations were introduced using the "quick exchange site-directed mutagenesis kit" from Stratagene (La Jolla, Calif., USA) following the manufacturer's protocol and using the corresponding primers (FIG. 14). All mutations made are summarized in Table 1A and B wherein T1 to T7 and N1 to N6, respectively, refer to the muteins and "Mutation" to the amino acids replaced at such position. For example T5 refers to a mutein with a double mutation: L at position 27 for Q and L at position 274 for Q. The primer sets (A-H) used to introduce the corresponding mutations are shown in FIG. 14a. The newly introduced amino acid is shown in bold and the subscript indicates the position in the mature Aspergillus fumigatus enzyme concerning to the numbering of the A. niger amino acid sequence. FIGS. 15 and 16 outline the scheme for the construction of different plasmids pgT1-pgT7 and pgN1-pgN6 encoding the muteins carrying only one mutation (T1-T4; N1-N3) or more mutations (T5-T7; N4-N6). Clones harboring the desired mutations were identified by DNA sequence analysis as known in the art. The mutated phytases were verified by complete sequencing of the genes.

Example 4

Construction of Muteins of the Phytase of Aspergillus fumigatus for Expression in Saccharomyces cerevisiae

Construction of plasmids pcT1-pcT7 (FIG. 17a) and pcN1-pcN6 (FIG. 18), respectively, encoding the muteins T1-T7 and N1-N6 for the expression in S. cerevisiae was basically done as outlined in Example 3. Instead of using pUC18-AfumgDNA as the basic construct to introduce the mutations, plasmid pUC18-AfumeDNA was used (FIG. 13).

The plasmids pcDNA-N27, -G27, -V27, -A27, -127 and -T27 encoding the muteins N27, G27, V27, A27, I27 and T27 were constructed as follows:

A silent restriction site for AvrII was introduced into plasmid pcT1 by site directed mutagenesis as described in Example 3 using primer set I (FIG. 14a; FIG. 17b). The A. fumigatus phytase gene fragment AvrII/XhoI was then replaced by the linker fragment harbouring the desired mutations (FIG. 17c). Each linker fragment was generated by annealing of the respective pairs of synthesized polynucleotides (FIG. 14b; sense and antisense strand; 90 ng each) for 3 min at 70 .GAMMA.C in 9 .mu.l distilled water.

Construction of plasmids pcT1-S66D and pcT1-S140Y-D141G encoding the A. fumigatus Q27L-S66D double mutant and the A. fumigatus Q27L-S140Y-141G triple mutant was basically carried out as described in Example 3. Plasmid pcT1, harbouring the mutation coding for Q27L, was used as template for site directed mutagenesis together with the corresponding primer sets J andK (FIG. 14a; FIG. 17b).

All mutations were verified by DNA sequence analysis of the entire gene.

Example 5

Expression in Aspergillus niger

The genes encoding the aforementioned A. fumigatus wild-type phytase and muteins (FIG. 16) were isolated with BspHI and EcoRV from plasmids pgDNAT1-pgDNAT7 and pgDNAN1-pgDNAN6 and ligated into the NcoI site downstream of the glucoamylase promoter of Aspergillus niger (glaA) and the EcoRV site upstream of the Aspergillus nidulans tryptophan C terminator (trpC) (Mullaney et al., 1985). The resulting expression plasmids had in addition the orotidine-5'-phosphate decarboxylase gene (pyr4) of Neurospora crassa as selection marker. FIG. 19 shows an example for such an expression plasmid carrying the gene encoding mutein T1 (van den Hondel et al., 1991). The basic expression plasmid described above corresponds basically to the pGLAC vector described in example 9 of EP 684 313. Transformation of Aspergillus niger and expression of the muteins was done as described in EP 684 313.

The supernatant was concentrated by way of ultrafiltration in Amicon 8400 cells (PM30 membranes) and ultrafree-15 centrifugal filter devices (Biomax-30K, Millipore).

The concentrate (typically 1.5-5 ml) was desalted in aliquots of 1.5 ml on a Fast Desalting HR 10/10 column (Pharmacia Biotech), with 10 mM sodium acetate, pH 5.0, serving as elution buffer. The desalted A. fumigatus samples were directly loaded onto a 1.7 ml Poros HS/M cation exchange chromatography column (PerSeptive Biosystems, Framingham, Mass., USA). A. terreus cbs116.46 [CBS 220.95] phytase was directly loaded onto a 1.7 ml Poros HQ/M anion exchange chromatography column. In both cases, phytase was eluted in pure form by way of a sodium chloride gradient.

References

Mullaney, E. J., J. E. Hamer, K. A. Roberti, M. M. Yelton, and W. E. Timberlake. 1985. Primary structure of the trpC gene from Aspergillus nidulans. Mol. Gen. Genet. 199:37-45.

Van den Hondel, C. A. M. J. J., P. J. Punt, and R. F. M. van Gorcom. 1991. Heterologous gene expression in filamentous fungi. In: More gene manipulations in fungi. pp. 396-428. Bennett, J. W. and Lasure, L. L. (eds.). Academic Press Inc., San Diego, Calif.

Example 6

Expression in Saccharomyces cerevisiae

The intron less genes encoding the A. fumigatus wild-type phytase and the different muteins (FIGS. 17/18) mentioned above were isolated from the respective plasmids pUC18-AfumcDNA, pcDNAT1-pcDNAT7 and pcDNAN1-pcDNAN6 with EcoRI and EcoRV and subcloned either between the blunt ended XhoI and the EcoRI sites of plasmid pYES2 (Invitrogen, San Diego, Calif., USA) or the shortened GAPFL (glyceraldehyde-3-phosphate dehydrogenase) promoter and the PHO5 terminator as described by Janes et al. (1990). Transformation of Saccharomyces cerevisiae strains, e.g. INVSc1 (Invitrogen, San Diego, Calif., USA) was done according to Hinnen et al. (1978). Single colonies harbouring the phytase gene under the control of the GAPFL promoter were picked and cultivated in 5ml selection medium (SD -uracil) (Sherman et al., 1986) at 30.GAMMA. C under vigorous shaking (250 rpm) for 1 day. The preculture was then added to 500 ml YPD medium (Sherman et al., 1986) and cultivated under the same conditions. After four days cell broth was centrifuged (7000 rpm, GS3 rotor, 15 min. 5.GAMMA. C) and the supernatant was collected. Induction of the GALL promotor (plasmid pYES2 from Invitrogen, San Diego, Calif., USA) was done according to the manufacturers instructions. Purification of the muteins was as described in example 5 (s.a.).

References

Janes, M., B. Meyhack, W. Zimmermann and A. Hinnen. 1990. The influence of GAP promoter variants on hirudine production, avarage plasmid copy number and cell growth in Saccharomyces cerevisiae. Curr. Genet. 18: 97-103

Hinnen, A., J. B. Hicks and G. R. Fink. 1978. Proc. Natl. Acad. Sci. USA 75: 1929-1933

Sheman, J. P., Finck, G. R. and Hicks, J. B. (1986). Laboratory Course Manual for Methods in Yeast Genetics. Cold Spring Harbor University Press.

Example 7

Determination of Phytase Activity and Substrate Specificity

Phytase activity was measured in an assay mixture containing 0.5% phytic acid (.about.5 mM), 200 mM sodium acetate, pH 5.0. After 15 min incubation at 37.degree. C., the reaction was stopped by addition of an equal volume of 15% trichloroacetic acid. The liberated phosphate ions were quantified by mixing 100 .mu.l of the assay mixture with 900 .mu.l H.sub.2 O and 1 ml of 0.6 M H.sub.2 SO.sub.4, 2% ascorbic acid and 0.5% ammonium molybdate. Standard solutions of potassium phosphate were used as reference.

In case of pH optimum curves, purified enzymes were diluted in 10 mM sodium acetate, pH 5.0. Incubations were started by mixing aliquots of the diluted protein with an equal volume of 1% phytic acid (.about.10 mM) in a series of different buffers: 0.4 M glycine/HCl, pH 2.5; 0.4 M acetate/NaOH, pH 3.0, 3.5, 4.0, 4.5, 5.0, 5.5; 0.4 M imidazole/HCl, pH 6.0, 6.5; 0.4 M Tris/HCl, pH 7.0, 7.5, 8.0, 8.5, 9.0. Control experiments showed that pH was only slightly affected by the mixing step. Incubations were performed for 15 min at 37.degree. C. as described above.

For determination of the substrate specificities of wild-type and mutant A. fumigatus phytases, phytic acid in the assay mixture was replaced by 5 mM-concentrations of the respective phosphate compounds. The activity tests were performed as described above.

Protein concentrations were calculated from the OD at 280 nm, using theoretical absorption values calculated from the known protein sequences with the DNA* software (DNASTAR, Inc., Madison, Wis., USA). An absorption of 1.0 OD at 280 nm corresponds to 0.94 mg/ml A. fumigatus phytase and 0.85 mg/ml of A. terreus cbs116.46 phytase.

pH profiles of Aspergillus fumigatus mutants T1 (Q27L), T5 (Q27L, Q274L) and T6 (Q27L, Q274L, G277D) have drastically changed compared to the wild-type A. fumigatus phytase (see FIG. 2). All mutants showed equal pH profiles. Increase in specific activity at pH 5.0 of the muteins as compared to the wild-type phytase of Aspergillus fumigatus is shown in Table 2. Enzyme activities were measured under standard assay conditions at pH 5.0. Several individual measurements (n: number of assays) were averaged.

The pH profile of A. fumigatus phytase mutant Q27A resembles the pH profile of A. fumigatus wild-type phytase over nearly the whole pH range (FIG. 20). Whereas the specific activity of wild-type phytase is decreasing at pH values below pH 4.0, the specific activity of the phytase mutant Q27A remains nearly constant down to pH 2.9.

The single amino acid exchanges Q27L, Q27I, Q27V or Q27T have remarkably increased the specific activity over the whole pH range, especially between pH 5.0 and 7.5 (FIG. 20). Maximum values are reached at pH 6.5. In addition, mutation Q27T caused the highest specific activity values for phytic acid at low pH (pH 3.0-5.0).

Higher specific activities are also gained by the single mutations Q27G or Q27N, between pH 2.5 and 7.0, with maximum values at pH 6.0 (FIG. 20). The specific activity decreases at pH values below 3.5.

All single mutants still show a broad substrate specificity which is comparable to that of A. fumigatus wild-type phytase (FIG. 21). Some of the mutants show significantly higher specific activities than other mutants for selected substrates, e. g., the Q27T mutant for p-nitrophenyl phosphate and ATP, or the Q27G mutant for phosphoenolpyruvate.

As shown in FIG. 22 the combination of mutation Q27L with S66D or S140Y and D141G led to a shift of the pH profile towards lower pH. The maximum specific activity gained by the single mutation Q27L is further increased by the additional amino acid exchanges.

As shown in FIG. 3, Aspergillus fumigatus phytase mutant T1 (Q27L) showed no difference in substrate specificity compared to the triple mutant T6 (Q27L, Q274L, G277D).

The pH profiles of the muteins N1-6, except N2 show significant differences compared to the wild-type phytase (FIG. 10). Whereas the pH profile of mutein N4 is expanded towards lower pH, the profiles of muteins N3 to N6 are shifted towards lower pH. The muteins N5, N6 reach maximum activity already at pH 3.0.

The muteins N1 to N6 show in almost all cases a drastic reduction in specific activity for all tested substrates, except for phytic acid (FIG. 9). Specific activity for phytic acid remained unchanged compared to the wild-type phytase, whereas mutant N3 and N6 show a tendential higher activity (FIG. 19).

TABLE 1 A) Mutations towards A. terreus cbs116.46 phytase Mutation T1 T2 T3 T4 T5 T6 T7 Q27L X X X X Q274L X X X X G277D X X X N340S X x B) Mutations towards A. niger (ficuum) phytase Mutation N1 N2 N3 N4 N5 N6 G277K X X A205E X X X Y282H X X x

TABLE 1 A) Mutations towards A. terreus cbs116.46 phytase Mutation T1 T2 T3 T4 T5 T6 T7 Q27L X X X X Q274L X X X X G277D X X X N340S X x B) Mutations towards A. niger (ficuum) phytase Mutation N1 N2 N3 N4 N5 N6 G277K X X A205E X X X Y282H X X x

TABLE 3 Specific activity under standard assay conditions at pH 5.0. Average standard deviation is 10%. Number of Specific activity independent [U/mg] assays A. fumigatus wild- 26.5 22 type phytase A. fumigatus Q27N 45.5 3 A. fumigatus Q27T 106.9 3 A. fumigatus Q27L 83.4 4 A. fumigatus Q27I 91.2 3 A. fumigatus Q27V 35.0 3 A. fumigatus Q27A 27.3 3 A. fumigatus Q27G 59.6 3 A. fumigatus 118.5 3 Q27L-S66D A. fumigatus 193.0 3 Q27L-S140Y-D141G

Example 8

As an alternative approach to obtain phytases with modified characteristics and to get a better idea about the natural variation found in phytase characteristics within a certain species, naturally occurring variants of A. fumigatus phytase were analysed. Phytase genes were obtained from six different isolates of A. fumigatus. The amino acid sequence of phytase from two of the A. fumigatus isolates (ATCC 26934 and ATCC 34625) showed no difference to the original amino acid sequence of wild-type A. fumigatus phytase ATCC 13073. Phytase from three other isolates had one or two amino acid substitutions, none of which directly affected the active site. Enzymatic characteristics remained unaffected by these substitutions (not shown). The phytase of isolate of A. fumigatus (ATCC 32239) differed in 13 positions in the signal sequence and 51 positions in the mature part of the protein compared to the original wild-type A. fumigatus phytase (ATCC 13073). Several of these substitutions affect variable amino acids of the active site cavity. This resulted in an increase in specific activity with phytic acid as substrate (47 U/mg, standard enzyme assay) and in loss of enzymatic activity above pH 7 (FIG. 24). Also in this case, the specific activity against phytic acid was increased relative to the specific activities with other substrates (FIG. 25).

Example 9

Construction of plasmids pc-S130N, pc-R129L-S130N, pc-K167G-R168Q encoding A. fumigatus [ATCC 13073] phytase S130N single mutant and R129L-S130N double mutant and A. nidulans phytase K167G-R168Q double mutant was basically carried out as described in Example 3. Plasmid pUC18-AfumcDNA was used as template for site directed mutagenesis together with the corresponding primer sets L, M and N (FIG. 14a; FIG. 26).

All mutations were verified by DNA sequence analysis of the entire gene.

Example 10

When expressed in A. niger and stored as concentrated culture supernatants at 4.degree. C., the phytases from A. fumigatus, A. nidulans displayed tendency to undergo proteolytic degradation. N-terminal sequencing of fragments suggested that cleavage occured between amino acids S130-V131 and K167-R168 or R168-A169, respectively. Compared with 3D structure of A. niger phytase revealed that all cleavage sites are found within surface-exposed loop structures and are therefore accessible to proteases.

Site-directed mutagenesis at protease-sensitive sites of A. fumigatus phytase (S130N, R129L-S130N) andA. nidulans phytase (K167G-R168Q) yielded mutant proteins with considerably reduced susceptibility to proteolysis.

In contrast to expression in A. niger, proteolytic degradation was not observed when the phytases were expressed in Hansenula polymorpha.

SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 82 <210> SEQ ID NO 1 <211> LENGTH: 444 <212> TYPE: PRT <213> ORGANISM: Aspergillus niger <400> SEQUENCE: 1 Ala Ser Arg Asn Gln Ser Ser Cys Asp Thr Val Asp Gln Gly Tyr Gln 1 5 10 15 Cys Phe Ser Glu Thr Ser His Leu Trp Gly Gln Tyr Ala Pro Phe Phe 20 25 30 Ser Leu Ala Asn Glu Ser Val Ile Ser Pro Glu Val Pro Ala Gly Cys 35 40 45 Arg Val Thr Phe Ala Gln Val Leu Ser Arg His Gly Ala Arg Tyr Pro 50 55 60 Thr Asp Ser Lys Gly Lys Lys Tyr Ser Ala Leu Ile Glu Glu Ile Gln 65 70 75 80 Gln Asn Ala Thr Thr Phe Asp Gly Lys Tyr Ala Phe Leu Lys Thr Tyr 85 90 95 Asn Tyr Ser Leu Gly Ala Asp Asp Leu Thr Pro Phe Gly Glu Gln Glu 100 105 110 Leu Val Asn Ser Gly Ile Lys Phe Tyr Gln Arg Tyr Glu Ser Leu Thr 115 120 125 Arg Asn Ile Val Pro Phe Ile Arg Ser Ser Gly Ser Ser Arg Val Ile 130 135 140 Ala Ser Gly Lys Lys Phe Ile Glu Gly Phe Gln Ser Thr Lys Leu Lys 145 150 155 160 Asp Pro Arg Ala Gln Pro Gly Gln Ser Ser Pro Lys Ile Asp Val Val 165 170 175 Ile Ser Glu Ala Ser Ser Ser Asn Asn Thr Leu Asp Pro Gly Thr Cys 180 185 190 Thr Val Phe Glu Asp Ser Glu Leu Ala Asp Thr Val Glu Ala Asn Phe 195 200 205 Thr Ala Thr Phe Val Pro Ser Ile Arg Gln Arg Leu Glu Asn Asp Leu 210 215 220 Ser Gly Val Thr Leu Thr Asp Thr Glu Val Thr Tyr Leu Met Asp Met 225 230 235 240 Cys Ser Phe Asp Thr Ile Ser Thr Ser Thr Val Asp Thr Lys Leu Ser 245 250 255 Pro Phe Cys Asp Leu Phe Thr His Asp Glu Trp Ile Asn Tyr Asp Tyr 260 265 270 Leu Gln Ser Leu Lys Lys Tyr Tyr Gly His Gly Ala Gly Asn Pro Leu 275 280 285 Gly Pro Thr Gln Gly Val Gly Tyr Ala Asn Glu Leu Ile Ala Arg Leu 290 295 300 Thr His Ser Pro Val His Asp Asp Thr Ser Ser Asn His Thr Leu Asp 305 310 315 320 Ser Ser Pro Ala Thr Phe Pro Leu Asn Ser Thr Leu Tyr Ala Asp Phe 325 330 335 Ser His Asp Asn Gly Ile Ile Ser Ile Leu Phe Ala Leu Gly Leu Tyr 340 345 350 Asn Gly Thr Lys Pro Leu Ser Thr Thr Thr Val Glu Asn Ile Thr Gln 355 360 365 Thr Asp Gly Phe Ser Ser Ala Trp Thr Val Pro Phe Ala Ser Arg Leu 370 375 380 Tyr Val Glu Met Met Gln Cys Gln Ala Glu Gln Glu Pro Leu Val Arg 385 390 395 400 Val Leu Val Asn Asp Arg Val Val Pro Leu His Gly Cys Pro Val Asp 405 410 415 Ala Leu Gly Arg Cys Thr Arg Asp Ser Phe Val Arg Gly Leu Ser Phe 420 425 430 Ala Arg Ser Gly Gly Asp Trp Ala Glu Cys Phe Ala 435 440 <210> SEQ ID NO 2 <211> LENGTH: 438 <212> TYPE: PRT <213> ORGANISM: Aspergillus terreus <400> SEQUENCE: 2 Ser Asp Cys Thr Ser Val Asp Arg Gly Tyr Gln Cys Phe Pro Glu Leu 1 5 10 15 Ser His Lys Trp Gly Leu Tyr Ala Pro Tyr Phe Ser Leu Gln Asp Glu 20 25 30 Ser Pro Phe Pro Leu Asp Val Pro Asp Asp Cys His Ile Thr Phe Val 35 40 45 Gln Val Leu Ala Arg His Gly Ala Arg Ser Pro Thr Asp Ser Lys Thr 50 55 60 Lys Ala Tyr Ala Ala Thr Ile Ala Ala Ile Gln Lys Asn Ala Thr Ala 65 70 75 80 Leu Pro Gly Lys Tyr Ala Phe Leu Lys Ser Tyr Asn Tyr Ser Met Gly 85 90 95 Ser Glu Asn Leu Thr Pro Phe Gly Arg Asn Gln Leu Gln Asp Leu Gly 100 105 110 Ala Gln Phe Tyr Arg Arg Tyr Asp Thr Leu Thr Arg His Ile Asn Pro 115 120 125 Phe Val Arg Ala Ala Asp Ser Ser Arg Val His Glu Ser Ala Glu Lys 130 135 140 Phe Val Glu Gly Phe Gln Asn Ala Arg Gln Gly Asp Pro His Ala Asn 145 150 155 160 Pro His Gln Pro Ser Pro Arg Val Asp Val Val Ile Pro Glu Gly Thr 165 170 175 Ala Tyr Asn Asn Thr Leu Glu His Ser Ile Cys Thr Ala Phe Glu Ala 180 185 190 Ser Thr Val Gly Asp Ala Ala Ala Asp Asn Phe Thr Ala Val Phe Ala 195 200 205 Pro Ala Ile Ala Lys Arg Leu Glu Ala Asp Leu Pro Gly Val Gln Leu 210 215 220 Ser Ala Asp Asp Val Val Asn Leu Met Ala Met Cys Pro Phe Glu Thr 225 230 235 240 Val Ser Leu Thr Asp Asp Ala His Thr Leu Ser Pro Phe Cys Asp Leu 245 250 255 Phe Thr Ala Ala Glu Trp Thr Gln Tyr Asn Tyr Leu Leu Ser Leu Asp 260 265 270 Lys Tyr Tyr Gly Tyr Gly Gly Gly Asn Pro Leu Gly Pro Val Gln Gly 275 280 285 Val Gly Trp Ala Asn Glu Leu Ile Ala Arg Leu Thr Arg Ser Pro Val 290 295 300 His Asp His Thr Cys Val Asn Asn Thr Leu Asp Ala Asn Pro Ala Thr 305 310 315
320 Phe Pro Leu Asn Ala Thr Leu Tyr Ala Asp Phe Ser His Asp Ser Asn 325 330 335 Leu Val Ser Ile Phe Trp Ala Leu Gly Leu Tyr Asn Gly Thr Lys Pro 340 345 350 Leu Ser Gln Thr Thr Val Glu Asp Ile Thr Arg Thr Asp Gly Tyr Ala 355 360 365 Ala Ala Trp Thr Val Pro Phe Ala Ala Arg Ala Tyr Ile Glu Met Met 370 375 380 Gln Cys Arg Ala Glu Lys Gln Pro Leu Val Arg Val Leu Val Asn Asp 385 390 395 400 Arg Val Met Pro Leu His Gly Cys Ala Val Asp Asn Leu Gly Arg Cys 405 410 415 Lys Arg Asp Asp Phe Val Glu Gly Leu Ser Phe Ala Arg Ala Gly Gly 420 425 430 Asn Trp Ala Glu Cys Phe 435 <210> SEQ ID NO 3 <211> LENGTH: 439 <212> TYPE: PRT <213> ORGANISM: Aspergillus fumigatus <400> SEQUENCE: 3 Ser Lys Ser Cys Asp Thr Val Asp Leu Gly Tyr Gln Cys Ser Pro Ala 1 5 10 15 Thr Ser His Leu Trp Gly Gln Tyr Ser Pro Phe Phe Ser Leu Glu Asp 20 25 30 Glu Leu Ser Val Ser Ser Lys Leu Pro Lys Asp Cys Arg Ile Thr Leu 35 40 45 Val Gln Val Leu Ser Arg His Gly Ala Arg Tyr Pro Thr Ser Ser Lys
50 55 60 Ser Lys Lys Tyr Lys Lys Leu Val Thr Ala Ile Gln Ala Asn Ala Thr 65 70 75 80 Asp Phe Lys Gly Lys Phe Ala Phe Leu Lys Thr Tyr Asn Tyr Thr Leu 85 90 95 Gly Ala Asp Asp Leu Thr Pro Phe Gly Glu Gln Gln Leu Val Asn Ser 100 105 110 Gly Ile Lys Phe Tyr Gln Arg Tyr Lys Ala Leu Ala Arg Ser Val Val 115 120 125 Pro Phe Ile Arg Ala Ser Gly Ser Asp Arg Val Ile Ala Ser Gly Glu 130 135 140 Lys Phe Ile Glu Gly Phe Gln Gln Ala Lys Leu Ala Asp Pro Gly Ala 145 150 155 160 Thr Asn Arg Ala Ala Pro Ala Ile Ser Val Ile Ile Pro Glu Ser Glu 165 170 175 Thr Phe Asn Asn Thr Leu Asp His Gly Val Cys Thr Lys Phe Glu Ala 180 185 190 Ser Gln Leu Gly Asp Glu Val Ala Ala Asn Phe Thr Ala Leu Phe Ala 195 200 205 Pro Asp Ile Arg Ala Arg Ala Glu Lys His Leu Pro Gly Val Thr Leu 210 215 220 Thr Asp Glu Asp Val Val Ser Leu Met Asp Met Cys Ser Phe Asp Thr 225 230 235 240 Val Ala Arg Thr Ser Asp Ala Ser Gln Leu Ser Pro Phe Cys Gln Leu 245 250 255 Phe Thr His Asn Glu Trp Lys Lys Tyr Asn Tyr Leu Gln Ser Leu Gly
260 265 270 Lys Tyr Tyr Gly Tyr Gly Ala Gly Asn Pro Leu Gly Pro Ala Gln Gly 275 280 285 Ile Gly Phe Thr Asn Glu Leu Ile Ala Arg Leu Thr Arg Ser Pro Val 290 295 300 Gln Asp His Thr Ser Thr Asn Ser Thr Leu Val Ser Asn Pro Ala Thr 305 310 315 320 Phe Pro Leu Asn Ala Thr Met Tyr Val Asp Phe Ser His Asp Asn Ser 325 330 335 Met Val Ser Ile Phe Phe Ala Leu Gly Leu Tyr Asn Gly Thr Glu Pro 340 345 350 Leu Ser Arg Thr Ser Val Glu Ser Ala Lys Glu Leu Asp Gly Tyr Ser 355 360 365 Ala Ser Trp Val Val Pro Phe Gly Ala Arg Ala Tyr Phe Glu Thr Met 370 375 380 Gln Cys Lys Ser Glu Lys Glu Pro Leu Val Arg Ala Leu Ile Asn Asp 385 390 395 400 Arg Val Val Pro Leu His Gly Cys Asp Val Asp Lys Leu Gly Arg Cys 405 410 415 Lys Leu Asn Asp Phe Val Lys Gly Leu Ser Trp Ala Arg Ser Gly Gly 420 425 430 Asn Trp Gly Glu Cys Phe Ser 435 <210> SEQ ID NO 4 <211> LENGTH: 1931 <212> TYPE: DNA <213> ORGANISM: Aspergillus nidulans <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (158)..(205) <221> NAME/KEY: CDS <222> LOCATION: (260)..(1600) <400> SEQUENCE: 4 tctgtaaccg atagcggacc gactaggcat cgttgatcca caatatctca gacaatgcaa 60 ctcagtcgaa tatgaagggc tacagccagc atttaaatac ggccgtctag gtcgggctcc 120 ggggatgagg aggagcaggc tcgtgttcat ttcggtc atg gct ttt ttc acg gtc 175 Met Ala Phe Phe Thr Val 1 5 gct ctt tcg ctt tat tac ttg cta tcg agg tgagatctct acaatatctg 225 Ala Leu Ser Leu Tyr Tyr Leu Leu Ser Arg 10 15 tctgcttagt tgaattggta cttatctgta caga gtc tct gct cag gcc cca gtg 280 Val Ser Ala Gln Ala Pro Val 20 gtc cag aat cat tca tgc aat acg gcg gac ggt gga tat caa tgc ttc 328 Val Gln Asn His Ser Cys Asn Thr Ala Asp Gly Gly Tyr Gln Cys Phe 25 30 35 ccc aat gtc tct cat gtt tgg ggt cag tac tcg ccg tac ttc tcc atc 376 Pro Asn Val Ser His Val Trp Gly Gln Tyr Ser Pro Tyr Phe Ser Ile 40 45 50 55 gag cag gag tca gct atc tct gag gac gtg cct cat ggc tgt gag gtt 424 Glu Gln Glu Ser Ala Ile Ser Glu Asp Val Pro His Gly Cys Glu Val 60 65 70 acc ttt gtg cag gtg ctc tcg cgg cat ggg gct agg tat ccg aca gag 472 Thr Phe Val Gln Val Leu Ser Arg His Gly Ala Arg Tyr Pro Thr Glu 75 80 85 tcg aag agt aag gcg tac tcg ggg ttg att gaa gca atc cag aag aat 520 Ser Lys Ser Lys Ala Tyr Ser Gly Leu Ile Glu Ala Ile Gln Lys Asn 90 95 100 gct acc tct ttt tgg gga cag tat gct ttt ctg gag agt tat aac tat 568 Ala Thr Ser Phe Trp Gly Gln Tyr Ala Phe Leu Glu Ser Tyr Asn Tyr 105 110 115 acc ctc ggc gcg gat gac ttg act atc ttc ggc gag aac cag atg gtt 616 Thr Leu Gly Ala Asp Asp Leu Thr Ile Phe Gly Glu Asn Gln Met Val 120 125 130 135 gat tcg ggt gcc aag ttc tac cga cgg tat aag aat ctc gcc agg aaa 664 Asp Ser Gly Ala Lys Phe Tyr Arg Arg Tyr Lys Asn Leu Ala Arg Lys 140 145 150 aat act cct ttt atc cgt gca tca ggg tct gac cgt gtc gtt gcg tct 712 Asn Thr Pro Phe Ile Arg Ala Ser Gly Ser Asp Arg Val Val Ala Ser 155 160 165 gcg gag aag ttc att aat gga ttt cgc aag gct cag ctc cac gac cat 760 Ala Glu Lys Phe Ile Asn Gly Phe Arg Lys Ala Gln Leu His Asp His 170
175 180 ggc tcc aaa cgt gct acg cca gtt gtc aat gtg att atc cct gaa atc 808 Gly Ser Lys Arg Ala Thr Pro Val Val Asn Val Ile Ile Pro Glu Ile 185 190 195 gat ggg ttt aac aac acc ctg gac cat agc acg tgc gta tct ttt gag 856 Asp Gly Phe Asn Asn Thr Leu Asp His Ser Thr Cys Val Ser Phe Glu 200 205 210 215 aat gat gag cgg gcg gat gaa att gaa gcc aat ttc acg gca att atg 904 Asn Asp Glu Arg Ala Asp Glu Ile Glu Ala Asn Phe Thr Ala Ile Met 220 225 230 gga cct ccg atc cgc aaa cgt ctg gaa aat gac ctc cct ggc atc aaa 952 Gly Pro Pro Ile Arg Lys Arg Leu Glu Asn Asp Leu Pro Gly Ile Lys 235 240 245 ctt aca aac gag aat gta ata tat ttg atg gat atg tgc tct ttc gac 1000 Leu Thr Asn Glu Asn Val Ile Tyr Leu Met Asp Met Cys Ser Phe Asp

250 255 260 acc atg gcg cgc acc gcc cac gga acc gag ctg tct cca ttt tgt gcc 1048 Thr Met Ala Arg Thr Ala His Gly Thr Glu Leu Ser Pro Phe Cys Ala 265 270 275 atc ttc act gaa aag gag tgg ctg cag tac gac tac ctt caa tct cta 1096 Ile Phe Thr Glu Lys Glu Trp Leu Gln Tyr Asp Tyr Leu Gln Ser Leu 280 285 290 295 tca aag tac tac ggc tac ggt gcc gga agc ccc ctt ggc cca gct cag 1144 Ser Lys Tyr Tyr Gly Tyr Gly Ala Gly Ser Pro Leu Gly Pro Ala Gln 300 305 310 gga att ggc ttc acc aac gag ctg att gcc cga cta acg caa tcg ccc 1192 Gly Ile Gly Phe Thr Asn Glu Leu Ile Ala Arg Leu Thr Gln Ser Pro 315 320 325 gtc cag gac aac aca agc acc aac cac act cta gac tcg aac cca gcc 1240 Val Gln Asp Asn Thr Ser Thr Asn His Thr Leu Asp Ser Asn Pro Ala 330 335
340 aca ttt ccg ctc gac agg aag ctc tac gcc gac ttc tcc cac gac aat 1288 Thr Phe Pro Leu Asp Arg Lys Leu Tyr Ala Asp Phe Ser His Asp Asn 345 350 355 agc atg ata tcg ata ttc ttc gcc atg ggt ctg tac aac ggc acc cag 1336 Ser Met Ile Ser Ile Phe Phe Ala Met Gly Leu Tyr Asn Gly Thr Gln 360 365 370 375 ccg ctg tca atg gat tcc gtg gag tcg atc cag gag atg gac ggt tac 1384 Pro Leu Ser Met Asp Ser Val Glu Ser Ile Gln Glu Met Asp Gly Tyr 380 385 390 gcg gcg tct tgg act gtt ccg ttt ggt gcg agg gct tac ttt gag ctc 1432 Ala Ala Ser Trp Thr Val Pro Phe Gly Ala Arg Ala Tyr Phe Glu Leu 395 400 405 atg cag tgc gag aag aag gag ccg ctt gtg cgg gta tta gtg aat gat 1480 Met Gln Cys Glu Lys Lys Glu Pro Leu Val Arg Val Leu Val Asn Asp 410 415 420 cgc gtt gtt cct ctt cat ggc tgc gca gtt gac aag ttt gga cgg tgc 1528 Arg Val Val Pro Leu His Gly Cys Ala Val Asp Lys Phe Gly Arg Cys 425 430 435 act ttg gac gat tgg gta gag ggc ttg aat ttt gca agg agc ggc ggg 1576 Thr Leu Asp Asp Trp Val Glu Gly Leu Asn Phe Ala Arg Ser Gly Gly 440 445 450 455 aac tgg aag act tgt ttt acc cta taaagggcgt ttgctcattc ataagtgttg 1630 Asn Trp Lys Thr Cys Phe Thr Leu 460 tgcaggtata ggaaggttag ggaattagct gtttggcttt actcttatta gaccaagaat 1690 gatttgtttg ttctcaaggc cttctagcat atcgtcaagt gggataaatc acctatcctc 1750 catgtgtagg tgaacccgct cttgcatcaa cctcttgtgt ttcagagtag tttcaccaaa 1810 catatcctcg tgtcctctct tctgctcttc ggtctcatat tacactgttc tctatctata 1870 tcgtcaacaa aactaccacc caaacaccaa atgtcacact ttccagcacg aaatttcttc 1930 g 1931 <210> SEQ ID NO 5 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Aspergillus nidulans <400> SEQUENCE: 5 Met Ala Phe Phe Thr Val Ala Leu Ser Leu Tyr Tyr Leu Leu Ser Arg 1 5 10 15 <210> SEQ ID NO 6 <211> LENGTH: 447 <212> TYPE: PRT <213> ORGANISM: Aspergillus nidulans <400> SEQUENCE: 6 Val Ser Ala Gln Ala Pro Val Val Gln Asn His Ser Cys Asn Thr Ala 1 5 10 15 Asp Gly Gly Tyr Gln Cys Phe Pro Asn Val Ser His Val Trp Gly Gln 20 25 30 Tyr Ser Pro Tyr Phe Ser Ile Glu Gln Glu Ser Ala Ile Ser Glu Asp 35 40 45 Val Pro His Gly Cys Glu Val Thr Phe Val Gln Val Leu Ser Arg His 50 55 60 Gly Ala Arg Tyr Pro Thr Glu Ser Lys Ser Lys Ala Tyr Ser Gly Leu 65 70 75 80 Ile Glu Ala Ile Gln Lys Asn Ala Thr Ser Phe Trp Gly Gln Tyr Ala 85 90 95 Phe Leu Glu Ser Tyr Asn Tyr Thr Leu Gly Ala Asp Asp Leu Thr Ile 100 105 110 Phe Gly Glu Asn Gln Met Val Asp Ser Gly Ala Lys Phe Tyr Arg Arg 115 120 125 Tyr Lys Asn Leu Ala Arg Lys Asn Thr Pro Phe Ile Arg Ala Ser Gly 130 135 140 Ser Asp Arg Val Val Ala Ser Ala Glu Lys Phe Ile Asn Gly Phe Arg 145 150 155 160 Lys Ala Gln Leu His Asp His Gly Ser Lys Arg Ala Thr Pro Val Val 165 170 175 Asn Val Ile Ile Pro Glu Ile Asp Gly Phe Asn Asn Thr Leu Asp His 180 185 190 Ser Thr Cys Val Ser Phe Glu Asn Asp Glu Arg Ala Asp Glu Ile Glu 195 200 205 Ala Asn Phe Thr Ala Ile Met Gly Pro Pro Ile Arg Lys Arg Leu Glu 210 215 220 Asn Asp Leu Pro Gly Ile Lys Leu Thr Asn Glu Asn Val Ile Tyr Leu 225 230
235 240 Met Asp Met Cys Ser Phe Asp Thr Met Ala Arg Thr Ala His Gly Thr 245 250 255 Glu Leu Ser Pro Phe Cys Ala Ile Phe Thr Glu Lys Glu Trp Leu Gln 260 265 270 Tyr Asp Tyr Leu Gln Ser Leu Ser Lys Tyr Tyr Gly Tyr Gly Ala Gly 275 280 285 Ser Pro Leu Gly Pro Ala Gln Gly Ile Gly Phe Thr Asn Glu Leu Ile 290 295 300 Ala Arg Leu Thr Gln Ser Pro Val Gln Asp Asn Thr Ser Thr Asn His 305 310 315 320 Thr Leu Asp Ser Asn Pro Ala Thr Phe Pro Leu Asp Arg Lys Leu Tyr 325 330 335 Ala Asp Phe Ser His Asp Asn Ser Met Ile Ser Ile Phe Phe Ala Met 340 345 350 Gly Leu Tyr Asn Gly Thr Gln Pro Leu Ser Met Asp Ser Val Glu Ser 355 360 365 Ile Gln Glu Met Asp Gly Tyr Ala Ala Ser Trp Thr Val Pro Phe Gly 370 375 380 Ala Arg Ala Tyr Phe Glu Leu Met Gln Cys Glu Lys Lys Glu Pro Leu 385 390 395 400 Val Arg Val Leu Val Asn Asp Arg Val Val Pro Leu His Gly Cys Ala 405 410 415 Val Asp Lys Phe Gly Arg Cys Thr Leu Asp Asp Trp Val Glu Gly Leu 420 425 430 Asn Phe Ala Arg Ser Gly Gly Asn Trp Lys Thr Cys Phe Thr Leu 435
440 445 <210> SEQ ID NO 7 <211> LENGTH: 1845 <212> TYPE: DNA <213> ORGANISM: Talaromyces thermophilus <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (288)..(335) <221> NAME/KEY: CDS <222> LOCATION: (391)..(1740) <400> SEQUENCE: 7 ttccacgctg aaagcctgac tgcgatttcc aagctgcatg caggctgctc aactgcctgc 60 ttatcttcat cagacgcaga tacacaacct ggtctgtaga tgcacccatg acggacgaac 120 gcaccgctct cttggcctcc agggacccgg aggtcgaggg cgatgaggtc gcgccctcga 180 cggcctccca gtccctgttg cagttgagat ctcgctgcga acgtcgaccg cagatatggt 240 tgtcttcgac gttttctcgc cttcgaggaa gaattgctgc tgtgacg atg agt ctg 296 Met Ser Leu 1 ttg ttg ctg gtg ctg tcc ggc ggg ttg gtc gcg tta tag tatgctcctt 345 Leu Leu Leu Val Leu Ser Gly Gly Leu Val Ala Leu 5 10 15 ctctctggtc atattgtttt ctgctaacgt tctcataatt gaagt gtc tca aga aat 402 Val Ser Arg Asn 20 ccg cat gtt gat agc cac tct tgc aat aca gtg gaa gga ggg tat cag 450 Pro His Val Asp Ser His Ser Cys Asn Thr Val Glu Gly Gly Tyr Gln 25 30 35 tgt cgt cca gaa atc tcc cac tcc tgg ggc cag tat tct cca ttc ttc 498 Cys Arg Pro Glu Ile Ser His Ser Trp Gly Gln Tyr Ser Pro Phe Phe 40 45 50 tcc ctg gca gac cag tcg gag atc tcg cca gat gtc cca cag aac tgc 546 Ser Leu Ala Asp Gln Ser Glu Ile Ser Pro Asp Val Pro Gln Asn Cys 55 60 65 aag att acg ttt gtc cag ctg ctt tct cgt cac ggc gct aga tac cct 594 Lys Ile Thr Phe Val Gln Leu Leu Ser Arg His Gly Ala Arg Tyr Pro 70 75 80 acg tct tcc aag acg gag ctg tat tcg cag ctg atc agt cgg att cag 642 Thr Ser Ser Lys Thr Glu Leu Tyr Ser Gln Leu Ile Ser Arg Ile Gln 85 90 95 100 aag acg gcg act gcg tac aaa ggc tac tat gcc ttc ttg aaa gac tac 690 Lys Thr Ala Thr Ala Tyr Lys Gly Tyr Tyr Ala Phe Leu Lys Asp Tyr 105 110 115 aga tac cag ctg gga gcg aac gac ctg acg ccc ttt ggg gaa aac cag 738 Arg Tyr Gln Leu Gly Ala Asn Asp Leu Thr Pro Phe Gly Glu Asn Gln 120 125 130 atg atc cag ttg ggc atc aag ttt tat aac cat tac aag agt ctc gcc 786 Met Ile Gln Leu Gly Ile Lys Phe Tyr Asn His Tyr Lys Ser Leu Ala 135 140 145 agg aat gcc gtc cca ttc gtt cgt tgc tcc ggc tct gat cgg gtc att 834 Arg Asn Ala Val Pro Phe Val Arg Cys Ser Gly Ser Asp Arg Val Ile 150 155 160 gcc tcg ggg aga ctt ttc atc gaa ggt ttc cag agc gcc aaa gtg ctg 882 Ala Ser Gly Arg Leu Phe Ile Glu Gly Phe Gln Ser Ala Lys Val Leu 165 170 175 180 gat cct cat tca gac aag cat gac gct cct ccc acg atc aac gtg atc 930 Asp Pro His Ser Asp Lys His Asp Ala Pro Pro Thr Ile Asn Val Ile 185 190 195 atc gag gag ggt ccg tcc tac aat aac acg ctc gac acc ggc agc tgt 978 Ile Glu Glu Gly Pro Ser Tyr Asn Asn Thr Leu Asp Thr Gly Ser Cys 200 205 210 cca gtc ttt gag gac agc agc ggg gga cat gac gca cag gaa aag ttc 1026 Pro Val Phe Glu Asp Ser Ser Gly Gly His Asp Ala Gln Glu Lys Phe
215 220 225 gca aag caa ttc gca cca gct atc ctg gaa aag atc aag gac cat ctt 1074 Ala Lys Gln Phe Ala Pro Ala Ile Leu Glu Lys Ile Lys Asp His Leu 230 235 240 ccc ggc gtg gac ctg gcc gtg tcg gat gta ccg tac ttg atg gac ttg 1122 Pro Gly Val Asp Leu Ala Val Ser Asp Val Pro Tyr Leu Met Asp Leu 245 250 255 260 tgt ccg ttt gag acc ttg gct cgc aac cac aca gac acg ctg tct ccg 1170 Cys Pro Phe Glu Thr Leu Ala Arg Asn His Thr Asp Thr Leu Ser Pro 265 270 275 ttc tgc gct ctt tcc acg caa gag gag tgg caa gca tat gac tac tac 1218 Phe Cys Ala Leu Ser Thr Gln Glu Glu Trp Gln Ala Tyr Asp Tyr Tyr 280 285 290 caa agt ctg ggg aaa tac tat ggc aat ggc ggg ggt aac ccg ttg ggg 1266 Gln Ser Leu Gly Lys Tyr Tyr Gly Asn Gly Gly Gly Asn Pro Leu Gly 295 300 305 cca gcc caa ggc gtg ggg ttt gtc aac gag ttg att gct cgc atg acc 1314 Pro Ala Gln Gly Val Gly Phe Val Asn Glu Leu Ile Ala Arg Met Thr 310 315 320 cat agc cct gtc cag gac tac acc acg gtc aac cac act ctt gac tcg 1362 His Ser Pro Val Gln Asp Tyr Thr Thr Val Asn His Thr Leu Asp Ser 325 330 335 340 aat ccg gcg aca ttc cct ttg aac gcg acg ctg tac gca gat ttc agc 1410 Asn Pro Ala Thr Phe Pro Leu Asn Ala Thr Leu Tyr Ala Asp Phe Ser 345 350 355 cac gac aac aca atg acg tca att ttc gcg gcc ttg ggc ctg tac aac
1458 His Asp Asn Thr Met Thr Ser Ile Phe Ala Ala Leu Gly Leu Tyr Asn 360 365 370 ggg acc gcg aag ctg tcc acg acc gag atc aag tcc att gaa gag acg 1506 Gly Thr Ala Lys Leu Ser Thr Thr Glu Ile Lys Ser Ile Glu Glu Thr 375 380 385 gac ggc tac tcg gcg gcg tgg acc gtt ccg ttc ggg ggg cga gcc tat 1554 Asp Gly Tyr Ser Ala Ala Trp Thr Val Pro Phe Gly Gly Arg Ala Tyr 390 395 400 atc gag atg atg cag tgt gat gat tcg gat gag cca gtc gtt cgg gtg 1602 Ile Glu Met Met Gln Cys Asp Asp Ser Asp Glu Pro Val Val Arg Val 405 410 415 420 ctg gtc aac gac cgg gtg gtg cca ctg cat ggc tgc gag gtg gac tcc 1650 Leu Val Asn Asp Arg Val Val Pro Leu His Gly Cys Glu Val Asp Ser 425 430 435 ctg ggg cga tgc aaa cga gac gac ttt gtc agg gga ctg agt ttt gcg 1698 Leu Gly Arg Cys Lys Arg Asp Asp Phe Val Arg Gly Leu Ser Phe Ala 440 445 450 cga cag ggt ggg aac tgg gag ggg tgt tac gct gct tct gag 1740 Arg Gln Gly Gly Asn Trp Glu Gly Cys Tyr Ala Ala Ser Glu 455 460 465 taggtttatt cagcgagttt cgacctttct atccttcaaa cactgcacaa agacacactg 1800 catgaaatgg taacaggcct ggagcgtttt agaaggaaaa aagtt 1845 <210> SEQ ID NO 8 <211> LENGTH: 15 <212> TYPE: PRT <213> ORGANISM: Talaromyces thermophilus <400> SEQUENCE: 8 Met Ser Leu Leu Leu Leu Val Leu Ser Gly Gly Leu Val Ala Leu 1 5 10 15 <210> SEQ ID NO 9 <211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM: Talaromyces thermophilus <400> SEQUENCE: 9 Val Ser Arg Asn Pro His Val Asp Ser His Ser Cys Asn Thr Val Glu 1 5 10 15 Gly Gly Tyr Gln Cys Arg Pro Glu Ile Ser His Ser Trp Gly Gln Tyr 20 25 30 Ser Pro Phe Phe Ser Leu Ala Asp Gln Ser Glu Ile Ser Pro Asp Val 35 40 45 Pro Gln Asn Cys Lys Ile Thr Phe Val Gln Leu Leu Ser Arg His Gly 50 55 60 Ala Arg Tyr Pro Thr Ser Ser Lys Thr Glu Leu Tyr Ser Gln Leu Ile 65 70 75 80 Ser Arg Ile Gln Lys Thr Ala Thr Ala Tyr Lys Gly Tyr Tyr Ala Phe 85 90 95 Leu Lys Asp Tyr Arg Tyr Gln Leu Gly Ala Asn Asp Leu Thr Pro Phe 100 105 110 Gly Glu Asn Gln Met Ile Gln Leu Gly Ile Lys Phe Tyr Asn His Tyr 115 120 125

Lys Ser Leu Ala Arg Asn Ala Val Pro Phe Val Arg Cys Ser Gly Ser 130 135 140 Asp Arg Val Ile Ala Ser Gly Arg Leu Phe Ile Glu Gly Phe Gln Ser 145 150 155 160 Ala Lys Val Leu Asp Pro His Ser Asp Lys His Asp Ala Pro Pro Thr 165 170 175 Ile Asn Val Ile Ile Glu Glu Gly Pro Ser Tyr Asn Asn Thr Leu Asp 180 185 190 Thr Gly Ser Cys Pro Val Phe Glu Asp Ser Ser Gly Gly His Asp Ala 195 200 205 Gln Glu Lys Phe Ala Lys Gln Phe Ala Pro Ala Ile Leu Glu Lys Ile 210 215 220 Lys Asp His Leu Pro Gly Val Asp Leu Ala Val Ser Asp Val Pro Tyr 225 230 235 240 Leu Met Asp Leu Cys Pro Phe Glu Thr Leu Ala Arg Asn His Thr Asp 245 250 255 Thr Leu Ser Pro Phe Cys Ala Leu Ser Thr Gln Glu Glu Trp Gln Ala 260 265 270 Tyr Asp Tyr Tyr Gln Ser Leu Gly Lys Tyr Tyr Gly Asn Gly Gly Gly 275 280 285 Asn Pro Leu Gly Pro Ala Gln Gly Val Gly Phe Val Asn Glu Leu Ile 290 295 300 Ala Arg Met Thr His Ser Pro Val Gln Asp Tyr Thr Thr Val Asn His 305 310 315 320 Thr Leu Asp Ser Asn Pro Ala Thr Phe Pro Leu Asn Ala Thr Leu Tyr 325 330 335 Ala Asp Phe Ser His Asp Asn Thr Met Thr Ser Ile Phe Ala Ala Leu 340 345 350 Gly Leu Tyr Asn Gly Thr Ala Lys Leu Ser Thr Thr Glu Ile Lys Ser 355 360 365 Ile Glu Glu Thr Asp Gly Tyr Ser Ala Ala Trp Thr Val Pro Phe Gly 370 375 380 Gly Arg Ala Tyr Ile Glu Met Met Gln Cys Asp Asp Ser Asp Glu Pro 385 390 395 400 Val Val Arg Val Leu Val Asn Asp Arg Val Val Pro Leu His Gly Cys 405 410 415 Glu Val Asp Ser Leu Gly Arg Cys Lys Arg Asp Asp Phe Val Arg Gly 420 425 430 Leu Ser Phe Ala Arg Gln Gly Gly Asn Trp Glu Gly Cys Tyr Ala Ala 435 440 445 Ser Glu 450 <210> SEQ ID NO 10 <211> LENGTH: 1571 <212> TYPE: DNA <213> ORGANISM: Aspergillus fumigatus <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (43)..(90) <221> NAME/KEY: CDS <222> LOCATION: (148)..(1494) <400> SEQUENCE: 10 agattcaacg acggaggaat cgcaacccta attgtcggta tc atg gtg act ctg 54 Met Val Thr Leu 1 act ttc ctg ctt tcg gcg gcg tat ctg ctt tct ggg tgagtggctt 100 Thr Phe Leu Leu Ser Ala Ala Tyr Leu Leu Ser Gly 5 10 15 ggatctattg ctcggatagg gctgtggtgc tgattctgaa acggagt aga gtg tct 156 Arg Val Ser gcg gca cct agt tct gct ggc tcc aag tcc tgc gat acg gta gac ctc 204 Ala Ala Pro Ser Ser Ala Gly Ser Lys Ser Cys Asp Thr Val Asp Leu 20 25 30 35 ggg tac cag tgc tcc cct gcg act tct cat cta tgg ggc cag tac tcg 252 Gly Tyr Gln Cys Ser Pro Ala Thr Ser His Leu Trp Gly Gln Tyr Ser 40 45 50 cca ttc ttt tcg ctc gag gac gag ctg tcc gtg tcg agt aag ctt ccc 300 Pro Phe Phe Ser Leu Glu Asp Glu Leu Ser Val Ser Ser Lys Leu Pro 55 60 65 aag gat tgc cgg atc acc ttg gta cag gtg cta tcg cgc cat gga gcg 348 Lys Asp Cys Arg Ile Thr Leu Val Gln Val Leu Ser Arg His Gly Ala 70 75 80 cgg tac cca acc agc tcc aag agc aaa aag tat aag aag ctt gtg acg 396 Arg Tyr Pro Thr Ser Ser Lys Ser Lys Lys Tyr Lys Lys Leu Val Thr 85 90 95 gcg atc cag gcc aat gcc acc gac ttc aag ggc aag ttt gcc ttt ttg 444 Ala Ile Gln Ala Asn Ala Thr Asp Phe Lys Gly Lys Phe Ala Phe Leu 100 105 110 115 aag acg tac aac tat act ctg ggt gcg gat gac ctc act ccc ttt ggg 492 Lys Thr Tyr Asn Tyr Thr Leu Gly Ala Asp Asp Leu Thr Pro Phe Gly 120 125 130 gag cag cag ctg gtg aac tcg ggc atc aag ttc tac cag agg tac aag 540 Glu Gln Gln Leu Val Asn Ser Gly Ile Lys Phe Tyr Gln Arg Tyr Lys 135 140 145 gct ctg gcg cgc agt gtg gtg ccg ttt att cgc gcc tca ggc tcg gac 588 Ala Leu Ala Arg Ser Val Val Pro Phe Ile Arg Ala Ser Gly Ser Asp 150 155 160 cgg gtt att gct tcg gga gag aag ttc atc gag ggg ttc cag cag gcg 636 Arg Val Ile Ala Ser Gly Glu Lys Phe Ile Glu Gly Phe Gln Gln Ala 165 170 175 aag ctg gct gat cct ggc gcg acg aac cgc gcc gct ccg gcg att agt 684 Lys Leu Ala Asp Pro Gly Ala Thr Asn Arg Ala Ala Pro Ala Ile Ser 180 185 190 195 gtg att att ccg gag agc gag acg ttc aac aat acg ctg gac cac ggt 732 Val Ile Ile Pro Glu Ser Glu Thr Phe Asn Asn Thr Leu Asp His Gly 200 205 210 gtg tgc acg aag ttt gag gcg agt cag ctg gga gat gag gtt gcg gcc 780 Val Cys Thr Lys Phe Glu Ala Ser Gln Leu Gly Asp Glu Val Ala Ala 215 220 225 aat ttc act gcg ctc ttt gca ccc gac atc cga gct cgc gcc gag aag 828 Asn Phe Thr Ala Leu Phe Ala Pro Asp Ile Arg Ala Arg Ala Glu Lys 230 235 240 cat ctt cct ggc gtg acg ctg aca gac gag gac gtt gtc agt cta atg
876 His Leu Pro Gly Val Thr Leu Thr Asp Glu Asp Val Val Ser Leu Met 245 250 255 gac atg tgt tcg ttt gat acg gta gcg cgc acc agc gac gca agt cag 924 Asp Met Cys Ser Phe Asp Thr Val Ala Arg Thr Ser Asp Ala Ser Gln 260 265 270 275 ctg tca ccg ttc tgt caa ctc ttc act cac aat gag tgg aag aag tac 972 Leu Ser Pro Phe Cys Gln Leu Phe Thr His Asn Glu Trp Lys Lys Tyr 280 285 290 aac tac ctt cag tcc ttg ggc aag tac tac ggc tac ggc gca ggc aac 1020 Asn Tyr Leu Gln Ser Leu Gly Lys Tyr Tyr Gly Tyr Gly Ala Gly Asn 295 300 305 cct ctg gga ccg gct cag ggg ata ggg ttc acc aac gag ctg att gcc 1068 Pro Leu Gly Pro Ala Gln Gly Ile Gly Phe Thr Asn Glu Leu Ile Ala 310 315 320 cgg ttg act cgt tcg cca gtg cag gac cac acc agc act aac tcg act 1116 Arg Leu Thr Arg Ser Pro Val Gln Asp His Thr Ser Thr Asn Ser Thr 325 330 335 cta gtc tcc aac ccg gcc acc ttc ccg ttg aac gct acc atg tac gtc 1164 Leu Val Ser Asn Pro Ala Thr Phe Pro Leu Asn Ala Thr Met Tyr Val 340 345 350 355 gac ttt tca cac gac aac agc atg gtt tcc atc ttc ttt gca ttg ggc 1212 Asp Phe Ser His Asp Asn Ser Met Val Ser Ile Phe Phe Ala Leu Gly 360 365 370 ctg tac aac ggc act gaa ccc ttg tcc cgg acc tcg gtg gaa agc gcc 1260 Leu Tyr Asn Gly Thr Glu Pro Leu Ser Arg Thr Ser Val Glu Ser Ala 375 380
385 aag gaa ttg gat ggg tat tct gca tcc tgg gtg gtg cct ttc ggc gcg 1308 Lys Glu Leu Asp Gly Tyr Ser Ala Ser Trp Val Val Pro Phe Gly Ala 390 395 400 cga gcc tac ttc gag acg atg caa tgc aag tcg gaa aag gag cct ctt 1356 Arg Ala Tyr Phe Glu Thr Met Gln Cys Lys Ser Glu Lys Glu Pro Leu 405 410 415 gtt cgc gct ttg att aat gac cgg gtt gtg cca ctg cat ggc tgc gat 1404 Val Arg Ala Leu Ile Asn Asp Arg Val Val Pro Leu His Gly Cys Asp 420 425 430 435 gtg gac aag ctg ggg cga tgc aag ctg aat gac ttt gtc aag gga ttg 1452 Val Asp Lys Leu Gly Arg Cys Lys Leu Asn Asp Phe Val Lys Gly Leu 440 445 450 agt tgg gcc aga tct ggg ggc aac tgg gga gag tgc ttt agt 1494 Ser Trp Ala Arg Ser Gly Gly Asn Trp Gly Glu Cys Phe Ser 455 460 465 tgagatgtca ttgttatgct atactccaat agaccgttgc ttagccattc acttcacttt 1554 gctcgaaccg cctgccg 1571 <210> SEQ ID NO 11 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Aspergillus fumigatus <400> SEQUENCE: 11 Met Val Thr Leu Thr Phe Leu Leu Ser Ala Ala Tyr Leu Leu Ser Gly 1 5 10 15 <210> SEQ ID NO 12 <211> LENGTH: 449 <212> TYPE: PRT <213> ORGANISM: Aspergillus fumigatus <400> SEQUENCE: 12 Arg Val Ser Ala Ala Pro Ser Ser Ala Gly Ser Lys Ser Cys Asp Thr 1 5
10 15 Val Asp Leu Gly Tyr Gln Cys Ser Pro Ala Thr Ser His Leu Trp Gly 20 25 30 Gln Tyr Ser Pro Phe Phe Ser Leu Glu Asp Glu Leu Ser Val Ser Ser 35 40 45 Lys Leu Pro Lys Asp Cys Arg Ile Thr Leu Val Gln Val Leu Ser Arg 50 55 60 His Gly Ala Arg Tyr Pro Thr Ser Ser Lys Ser Lys Lys Tyr Lys Lys 65 70 75 80 Leu Val Thr Ala Ile Gln Ala Asn Ala Thr Asp Phe Lys Gly Lys Phe 85 90 95 Ala Phe Leu Lys Thr Tyr Asn Tyr Thr Leu Gly Ala Asp Asp Leu Thr 100 105 110 Pro Phe Gly Glu Gln Gln Leu Val Asn Ser Gly Ile Lys Phe Tyr Gln 115 120 125 Arg Tyr Lys Ala Leu Ala Arg Ser Val Val Pro Phe Ile Arg Ala Ser 130 135 140 Gly Ser Asp Arg Val Ile Ala Ser Gly Glu Lys Phe Ile Glu Gly Phe 145 150 155 160 Gln Gln Ala Lys Leu Ala Asp Pro Gly Ala Thr Asn Arg Ala Ala Pro 165 170 175 Ala Ile Ser Val Ile Ile Pro Glu Ser Glu Thr Phe Asn Asn Thr Leu 180 185 190 Asp His Gly Val Cys Thr Lys Phe Glu Ala Ser Gln Leu Gly Asp Glu 195 200 205 Val Ala Ala Asn Phe Thr Ala Leu Phe Ala Pro Asp Ile Arg Ala Arg 210 215 220 Ala Glu Lys His Leu Pro Gly Val Thr Leu Thr Asp Glu Asp Val Val 225 230 235 240 Ser Leu Met Asp Met Cys Ser Phe Asp Thr Val Ala Arg Thr Ser Asp 245 250 255 Ala Ser Gln Leu Ser Pro Phe Cys Gln Leu Phe Thr His Asn Glu Trp 260 265 270 Lys Lys Tyr Asn Tyr Leu Gln Ser Leu Gly Lys Tyr Tyr Gly Tyr Gly 275 280 285 Ala Gly Asn Pro Leu Gly Pro Ala Gln Gly Ile Gly Phe Thr Asn Glu 290 295 300 Leu Ile Ala Arg Leu Thr Arg Ser Pro Val Gln Asp His Thr Ser Thr 305 310 315 320 Asn Ser Thr Leu Val Ser Asn Pro Ala Thr Phe Pro Leu Asn Ala Thr 325 330 335 Met Tyr Val Asp Phe Ser His Asp Asn Ser Met Val Ser Ile Phe Phe 340 345 350 Ala Leu Gly Leu Tyr Asn Gly Thr Glu Pro Leu Ser Arg Thr Ser Val 355 360 365 Glu Ser Ala Lys Glu Leu Asp Gly Tyr Ser Ala Ser Trp Val Val Pro 370 375 380 Phe Gly Ala Arg Ala Tyr Phe Glu Thr Met Gln Cys Lys Ser Glu Lys 385 390 395 400 Glu Pro Leu Val Arg Ala Leu Ile Asn Asp Arg Val Val Pro Leu His 405 410 415 Gly Cys Asp Val Asp Lys Leu Gly Arg Cys Lys Leu Asn Asp Phe Val 420
425 430 Lys Gly Leu Ser Trp Ala Arg Ser Gly Gly Asn Trp Gly Glu Cys Phe 435 440 445 Ser <210> SEQ ID NO 13 <211> LENGTH: 1567 <212> TYPE: DNA <213> ORGANISM: Aspergillus terreus <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (78)..(125) <221> NAME/KEY: CDS <222> LOCATION: (178)..(1527) <400> SEQUENCE: 13 acgtcccagg tcggggacta catccgctat gtggtcctct acttcgtcgg aagaatatac 60 tgtctcttgt ggctacc atg ggg gtt ttc gtc gtt cta tta tct atc gcg 110 Met Gly Val Phe Val Val Leu Leu Ser Ile Ala 1 5 10 act ctg ttc ggc agg tatgtgcacc gctctaggtt caactcgcct ggtaactgac 165 Thr Leu Phe Gly Arg 15 aaacagtaca gc aca tcg ggc act gcg ctg ggc ccc cgt gga aat cac agc 216 Thr Ser Gly Thr Ala Leu Gly Pro Arg Gly Asn His Ser 20 25 gac tgc acc tca gtc gac cgg ggg tat caa tgc ttc cct gag ctc tcc 264 Asp Cys Thr Ser Val Asp Arg Gly Tyr Gln Cys Phe Pro Glu Leu Ser 30 35 40 45 cat aaa tgg ggt ctc tac gcg ccc tat ttc tcc ctc cag gat gaa tct 312 His Lys Trp Gly Leu Tyr Ala Pro Tyr Phe Ser Leu Gln Asp Glu Ser 50 55 60 ccg ttt cct ctg gac gtc ccg gat gac tgc cac atc acc ttt gtg cag 360 Pro Phe Pro Leu Asp Val Pro Asp Asp Cys His Ile Thr Phe Val Gln 65 70 75 gtg ctg gcc cga cat gga gcg cgg tct cca acc gat agc aag aca aag 408 Val Leu Ala Arg His Gly Ala Arg Ser Pro Thr Asp Ser Lys Thr Lys 80 85 90 gcg tat gcc gcg act att gca gcc atc cag aag aat gcc acc gcg ttg 456 Ala Tyr Ala Ala Thr Ile Ala Ala Ile Gln Lys Asn Ala Thr Ala Leu 95 100 105 ccg ggc aaa tac gcc ttc ctg aag tcg tac aat tac tcc atg ggc tcc 504

Pro Gly Lys Tyr Ala Phe Leu Lys Ser Tyr Asn Tyr Ser Met Gly Ser 110 115 120 125 gag aac ctg aac ccc ttc ggg cgg aac caa ctg caa gat ctg ggc gcc 552 Glu Asn Leu Asn Pro Phe Gly Arg Asn Gln Leu Gln Asp Leu Gly Ala 130 135 140 cag ttc tac cgt cgc tac gac acc ctc acc cgg cac atc aac cct ttc 600 Gln Phe Tyr Arg Arg Tyr Asp Thr Leu Thr Arg His Ile Asn Pro Phe 145 150 155 gtc cgg gcc gcg gat tcc tcc cgc gtc cac gaa tca gcc gag aag ttc 648 Val Arg Ala Ala Asp Ser Ser Arg Val His Glu Ser Ala Glu Lys Phe 160 165 170 gtc gag ggc ttc caa aac gcc cgc caa ggc gat cct cac gcc aac cct 696 Val Glu Gly Phe Gln Asn Ala Arg Gln Gly Asp Pro His Ala Asn Pro 175 180 185 cac cag ccg tcg ccg cgc gtg gat gta gtc atc ccc gaa ggc acc gcc 744 His Gln Pro Ser Pro Arg Val Asp Val Val Ile Pro Glu Gly Thr Ala 190 195 200 205 tac aac aac acg ctc gag cac agc atc tgc acc gcc ttc gag gcc agc 792 Tyr Asn Asn Thr Leu Glu His Ser Ile Cys Thr Ala Phe Glu Ala Ser 210 215 220 acc gtc ggc gac gcc gcg gca gac aac ttc act gcc gtg ttc gcg ccg 840 Thr Val Gly Asp Ala Ala Ala Asp Asn Phe Thr Ala Val Phe Ala Pro 225 230 235 gcg atc gcc aag cgt ctg gag gcc gat ctg ccc ggc gtg cag ctg tcc 888 Ala Ile Ala Lys Arg Leu Glu Ala Asp Leu Pro Gly Val Gln Leu Ser 240 245
250 gcc gac gac gtg gtc aat ctg atg gcc atg tgt ccg ttc gag acg gtc 936 Ala Asp Asp Val Val Asn Leu Met Ala Met Cys Pro Phe Glu Thr Val 255 260 265 agc ctg acc gac gac gcg cac acg ctg tcg ccg ttc tgc gac ctc ttc 984 Ser Leu Thr Asp Asp Ala His Thr Leu Ser Pro Phe Cys Asp Leu Phe 270 275 280 285 acc gcc gcc gag tgg acg cag tac aac tac ctg ctc tcg ctg gac aag 1032 Thr Ala Ala Glu Trp Thr Gln Tyr Asn Tyr Leu Leu Ser Leu Asp Lys 290 295 300 tac tac ggc tac ggc ggc ggc aat ccg ctg ggc ccc gtg cag ggc gtg 1080 Tyr Tyr Gly Tyr Gly Gly Gly Asn Pro Leu Gly Pro Val Gln Gly Val 305 310 315 ggc tgg gcg aac gag ctg atc gcg cgg ctg acg cgc tcc ccc gtc cac 1128 Gly Trp Ala Asn Glu Leu Ile Ala Arg Leu Thr Arg Ser Pro Val His 320 325 330 gac cac acc tgc gtc aac aac acc ctc gac gcc aac ccg gcc acc ttc 1176 Asp His Thr Cys Val Asn Asn Thr Leu Asp Ala Asn Pro Ala Thr Phe 335 340 345 ccg ctg aac gcc acc ctc tac gcg gac ttt tcg cac gac agt aac ctg 1224 Pro Leu Asn Ala Thr Leu Tyr Ala Asp Phe Ser His Asp Ser Asn Leu 350 355 360 365 gtg tcg atc ttc tgg gcg ctg ggt ctg tac aac ggc acc aag ccc ctg 1272 Val Ser Ile Phe Trp Ala Leu Gly Leu Tyr Asn Gly Thr Lys Pro Leu 370 375 380 tcg cag acc acc gtg gag gat atc acc cgg acg gac ggg tac gcg gcc 1320 Ser Gln Thr Thr Val Glu Asp Ile Thr Arg Thr Asp Gly Tyr Ala Ala 385 390 395 gcc tgg acg gtg ccg ttt gcc gcc cgc gcc tac atc gag atg atg cag 1368 Ala Trp Thr Val Pro Phe Ala Ala Arg Ala Tyr Ile Glu Met Met Gln 400 405 410 tgt cgc gcg gag aag cag ccg ctg gtg cgc gtg ctg gtc aac gac cgt 1416 Cys Arg Ala Glu Lys Gln Pro Leu Val Arg Val Leu Val Asn Asp Arg 415 420 425 gtc atg ccg ctg cac ggc tgc gcg gtg gat aat ctg ggc agg tgt aaa 1464 Val Met Pro Leu His Gly Cys Ala Val Asp Asn Leu Gly Arg Cys Lys
430 435 440 445 cgg gac gac ttt gtg gag gga ctg agc ttt gcg cgg gca gga ggg aac 1512 Arg Asp Asp Phe Val Glu Gly Leu Ser Phe Ala Arg Ala Gly Gly Asn 450 455 460 tgg gcc gag tgt ttc tgatgtacat gctgtagtta gctttgagtc ctgaggtacc 1567 Trp Ala Glu Cys Phe 465 <210> SEQ ID NO 14 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Aspergillus terreus <400> SEQUENCE: 14 Met Gly Val Phe Val Val Leu Leu Ser Ile Ala Thr Leu Phe Gly Arg 1 5 10 15 <210> SEQ ID NO 15 <211> LENGTH: 450 <212> TYPE: PRT <213> ORGANISM: Aspergillus terreus <400> SEQUENCE: 15 Thr Ser Gly Thr Ala Leu Gly Pro Arg Gly Asn His Ser Asp Cys Thr 1 5 10 15 Ser Val Asp Arg Gly Tyr Gln Cys Phe Pro Glu Leu Ser His Lys Trp 20 25 30 Gly Leu Tyr Ala Pro Tyr Phe Ser Leu Gln Asp Glu Ser Pro Phe Pro 35 40 45 Leu Asp Val Pro Asp Asp Cys His Ile Thr Phe Val Gln Val Leu Ala 50 55 60 Arg His Gly Ala Arg Ser Pro Thr Asp Ser Lys Thr Lys Ala Tyr Ala 65 70 75 80 Ala Thr Ile Ala Ala Ile Gln Lys Asn Ala Thr Ala Leu Pro Gly Lys 85 90 95 Tyr Ala Phe Leu Lys Ser Tyr Asn Tyr Ser Met Gly Ser Glu Asn Leu 100 105 110 Asn Pro Phe Gly Arg Asn Gln Leu Gln Asp Leu Gly Ala Gln Phe Tyr 115 120 125 Arg Arg Tyr Asp Thr Leu Thr Arg His Ile Asn Pro Phe Val Arg Ala 130 135 140 Ala Asp Ser Ser Arg Val His Glu Ser Ala Glu Lys Phe Val Glu Gly 145 150 155 160 Phe Gln Asn Ala Arg Gln Gly Asp Pro His Ala Asn Pro His Gln Pro 165 170 175 Ser Pro Arg Val Asp Val Val Ile Pro Glu Gly Thr Ala Tyr Asn Asn 180 185 190 Thr Leu Glu His Ser Ile Cys Thr Ala Phe Glu Ala Ser Thr Val Gly 195 200 205 Asp Ala Ala Ala Asp Asn Phe Thr Ala Val Phe Ala Pro Ala Ile Ala 210 215 220 Lys Arg Leu Glu Ala Asp Leu Pro Gly Val Gln Leu Ser Ala Asp Asp 225 230
235 240 Val Val Asn Leu Met Ala Met Cys Pro Phe Glu Thr Val Ser Leu Thr 245 250 255 Asp Asp Ala His Thr Leu Ser Pro Phe Cys Asp Leu Phe Thr Ala Ala 260 265 270 Glu Trp Thr Gln Tyr Asn Tyr Leu Leu Ser Leu Asp Lys Tyr Tyr Gly 275 280 285 Tyr Gly Gly Gly Asn Pro Leu Gly Pro Val Gln Gly Val Gly Trp Ala 290 295 300 Asn Glu Leu Ile Ala Arg Leu Thr Arg Ser Pro Val His Asp His Thr 305 310 315 320 Cys Val Asn Asn Thr Leu Asp Ala Asn Pro Ala Thr Phe Pro Leu Asn 325 330 335 Ala Thr Leu Tyr Ala Asp Phe Ser His Asp Ser Asn Leu Val Ser Ile 340 345 350 Phe Trp Ala Leu Gly Leu Tyr Asn Gly Thr Lys Pro Leu Ser Gln Thr 355 360 365 Thr Val Glu Asp Ile Thr Arg Thr Asp Gly Tyr Ala Ala Ala Trp Thr 370 375 380 Val Pro Phe Ala Ala Arg Ala Tyr Ile Glu Met Met Gln Cys Arg Ala 385 390 395 400 Glu Lys Gln Pro Leu Val Arg Val Leu Val Asn Asp Arg Val Met Pro 405 410 415 Leu His Gly Cys Ala Val Asp Asn Leu Gly Arg Cys Lys Arg Asp Asp 420 425 430 Phe Val Glu Gly Leu Ser Phe Ala Arg Ala Gly Gly Asn Trp Ala Glu
435 440 445 Cys Phe 450 <210> SEQ ID NO 16 <211> LENGTH: 33 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Nucleotide Sequence of Primer #39 designed based on Aspergillus fumigatus ATCC 13073 <400> SEQUENCE: 16 tatatcatga ttactctgac tttcctgctt tcg 33 <210> SEQ ID NO 17 <211> LENGTH: 9 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Amino Acid Sequence Corresponding to Primer #39 <400> SEQUENCE: 17 Met Ile Thr Leu Thr Phe Leu Leu Ser 1 5 <210> SEQ ID NO 18 <211> LENGTH:
30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Nucleotide Sequence of Primer #40 designed based on Aspergillus fumigatus ATCC 13073 <400> SEQUENCE: 18 tatatagata tctcaactaa agcactctcc 30 <210> SEQ ID NO 19 <211> LENGTH: 5 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Amino Acid Sequence Corresponding to Primer #40 <400> SEQUENCE: 19 Gly Glu Cys Phe Ser 1 5 <210> SEQ ID NO 20 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Fum28 PCR Primer <400> SEQUENCE: 20 atatatcggc cgagtgtctg cggcacctag t 31 <210> SEQ ID NO 21 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Fum11 PCR Primer <400> SEQUENCE: 21 tgaggtcatc cgcacccaga g 21 <210> SEQ ID NO 22 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Fum26 PCR Primer <400> SEQUENCE: 22 ctagaattca tggtgactct gactttcctg ctttcggcgg cgtatctgct ttcc 54 <210> SEQ ID NO 23 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Fum27 PCR Primer <400> SEQUENCE: 23 ggccggaaag cagatacgcc gccgaaagca ggaaagtcag agtcaccatg aatt 54 <210> SEQ ID NO 24 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Primer Q27L s <400> SEQUENCE: 24 catctatggg gcctgtactc gccattc 27 <210> SEQ ID NO 25 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Primer Q27L as <400> SEQUENCE: 25 gaatggcgag tacaggcccc atagatg 27 <210> SEQ ID NO 26 <211> LENGTH: 9 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Amino Acid Sequence Encoded by Primer Set A <400> SEQUENCE: 26 His Leu Trp Gly Leu Tyr Ser Pro Phe 1 5

<210> SEQ ID NO 27 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Primer Q274L s <400> SEQUENCE: 27 tacaactacc ttctgtcctt gggcaag 27 <210> SEQ ID NO 28 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Primer Q274L as <400> SEQUENCE: 28 cttgcccaag gacagaaggt agttgta 27 <210> SEQ ID NO 29 <211> LENGTH: 9 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Amino Aci